TABLE 1.

Probes and primers used in the miniaturized microarraya

Probe/geneProbe/gene functionTarget gene accession no.Pathotype(s)bControl strain (origin or reference)eProbe sequence (5′-3′)Primer sequence (5′-3′)
astA Heat-stable enterotoxinAE005345.1EAEC, ETECAbbotstown (22)
    astA_11 TCgTgCATATGGTGCgCAACAG GACGGCTTTGTAgTCCTTCC
    astA_21 TCgTgCATATGGTGCgCAACAG TGACGGCTTTGTAtTCCTTCC
bfpA Major subunit of bundle-forming piliAB024946.1EPECE2348/69 (16) GGTGTGATGTTTTACTACCAGTCTGC CGCTCATTACTTCTGAAATaGCA
cba Colicin B pore formingM16816.1UndesignatedEC2334/03 (VLA) GGATGGTCTGTCAGTGTGCACG GCGGAAACTTTCTCGTTTCC
cdtB Cytolethal distending toxin BAJ508930.1EPEC, STEC, ETEC, ExPEC*EC934/04 (VLA)
    cdtB_40 GCTGTTGATGCCtTtGGTGGAAG GCTAACCAGAGCAAGATTGAC
    cdtB_50 GCTGTTGATGCCcTtGGTGGAAG
celb Endonuclease colicin E2X03632.1UndesignatedEC2334/03 (VLA) GGACCGTATCTCCGTCATCAACAG GCGTTGCTAATCCGGTCAC
cfaC Colonization factor antigen IM55661.1ETECIMI100 (Bern) GGAATAGCGCGCTGGGTATTACAGA TCATCCACCAATTTAAGACAGC
cma Colicin M, resembles beta-lactam antibioticsM16754.1UndesignatedEC2334/03 (VLA) TGTAACGCCGACCGAAATCTGGT TCATAAACGCTTATTCCAGGGT
cnf Cytotoxic necrotizing factorAF483828.1ExPEC*S5 (8) CTTCCAGTATGGGGATCAGTTTTGATCA CGACGTTCTTCATAAGTATCACC
eae c IntiminAJ579371.1EPEC, EHECE2348/69 (25)
    eae_10 GTTACAaCaTTATGGAACGGCAGAGGT CgTCAAAGTTATtACCaCTCTGC
    eae_20 GTTACAaCgTTATGGAACGGCAGAGG AGTcTCGCCAgTATTCgC
    eae_30 TGGTgAtAATACCCGtTTAGGtATtGGt
    eae_40b TGGTgAtAATACCCGcTTAGGtATtGG
f17A c Subunit A of F17 fimbrial proteinAF022140.1ETEC, ExPEC*CK210 (6), S5 (8)
    f17A_40b ggTAcTAtGCaACgGgtcaGGC TGATAAgCGATGGTGTAATTcACaG
    f17A_50b CagTAcTAcGCaACgGgtgtGG TGATAAgCGATGGTGTAATTaACtG
    f17A_60b aCaaTAtTAtGCcACaGcgccGG CTGATAAaCGATGGTGTAATTtACtG
f17G Adhesin subunit of F17 fimbrial proteinAF022140.1ETEC, ExPEC*CK210 (6) TGCAATGGATAACCTGCCATTTGTCT CCAGACATTTGCATTCTGATATCC
fanA Involved in biogenesis of K99/F5 fimbriaeX05797.1ETECETEC562 (VLA) AGCAAGGTGCTTCCAATTATTAGTGGA CGTAAATACCCCTAGAACTACGT
fasA Fimbrial 987P/F6 subunitM35257.1ETECHM1535 (VLA) GCCAAGTGGATACTTCTAATCTGTCGC GAGCAGAAGTAGACAACTCTCC
fim41a Mature Fim41a/F41 proteinX14354.1ETECETEC562 (VLA) GGCTTGTTAATCCAGGTCGATTTACTG GAGAGTCCATTCCATTTATAGGCT
gad Glutamate decarboxylaseM84025.1All E. coliAll GATATCGTCTGGGACTTCCGCCT TGAAGCACTGATCGATTTCACA
ehx (hlyA)Hemolysin AAB011549.2EPEC, EHECEDL933 (19) TGTAGGATTAACTGAACGTGGTGTTGC GCAGAAGTTTGTCAAGTTGTGG
hlyE Avian E. coli hemolysinAF052225.1ExPEC*M1000 (14) CCAAGATAGATACTTCGAGGCGACAC TCACTCCACACCATTCATAAACT
ipaH9.8Invasion plasmid antigenAF047365.1 Shigella sonnei NCTC8192 (HPA)** TCGCGCTCACATGGAACAATCTC GCCTGATGGACCAGGAGG
ireA Siderophore receptorAF320691.1ExPEC*CFT073 (24) CCACAAATGACTTCTATCTGTCAGGC CTCCATATAGCTGAAGACCAAGT
iroN Enterobactin siderophore receptor proteinAF449498.1ExPEC*CFT073 (24) GCCTGTCGAGTAACATGATCAATGCT GAGGCTTTGCGAAGTGAGC
iss Increased serum survivalAF042279.1ExPEC*CFT073 (24) CCGCTCTGGCAATGCTTATTACAGG gGTTTGTTTccAACAGTAAACGT
K88ab K88/F4 protein subunit geneV00292.1ETECAbbotstown (22) GCCTGGATGACTGGTGATTTCAATGG GTGATACTACCACCGATATCGAC
lngA Longus type IV pilusAF004308.1ETECB1308 (VLA) CGTCTGGTTCATATGCCATGACAGC CCACAGACATATCTACACCAGT
lthA Heat-labile enterotoxin A subunitAB011677.1ETECETEC21d (VLA) GGTTTCTGCGTTAGGTGGAATACCA ACCAAAATTAACACGATACCATCC
mchB Microcin H47 part of colicin HAJ515252.1UndesignatedCFT073 (24) GGTTGTAGTTGGAGCCGTATCTGC GGTCGAGCCAATTGCTGT
mchC MchC proteinAJ515252.1UndesignatedCFT073 (24) CTGTCGGGTTAGATCTGTGATCCAC CCGGTGGTACAGGTAGATATCC
mchF ABC transporter protein MchFAJ515251.1UndesignatedCFT073 (24) TCCGGTTATTCATCAGACGGAGACC CAAAATGACCGCATATCATTGC
mcmA Microcin M part of colicin HAJ515251.1UndesignatedCFT073 (24) CCTCCATGTCTCCCTCAGGTATAGG GGCACTTGATGTACCTCTGC
perA c EPEC adherence factor, transcriptional activator
    perA_10AF255772.1EPECE2348/69 (16) TGTTTGGTTGGGTTTAATTCCACATCA TTGGTGTTGTGTTGTAATATTCCT
    perA_20N1743-95 (Bern) GCTTGGTTGGTTTTAATTCCACGTC
pet Autotransporter enterotoxinAF056581.1EAECNZ1470-95 (Bern) GCTGACAAGGATAATTCTGCCACAAGA GCATCGCGAGAGCAAACT
prfB/papB P-related fimbriae regulatory geneX76613.1ExPEC*CFT073 (24) GGGAGACTTATACGGCTGAATGCTC TCATCTGTATAATAAGGTGCAAGC
senB Plasmid-encoded enterotoxinZ54195.1EIECNCTC9774 (HPA) GCTCTATATCGGACACACCCAGTCAG GGTGTCAAACATACTGATACGC
sfaS S fimbria minor subunitX16664.4ExPEC*E536 (VLA) CAATGCAGGAAGTGGATCTCCATGG TCCGGTGAGAGACAGATCA
sta1A c Heat-stable enterotoxin ST-Ia
    sta1A_111AJ555214.1ETECETEC562 (VLA) ACACATTTTACTGCTGTGAACTTTGTTG AACATggAGCACAGGCAG
    sta1A_121 AACATccAGCACAGGCAG
sta1B Heat-stable enterotoxin ST-IbAY342058ETECIMI100 (Bern) AGCAATTACTGCTGTGAATTGTGTTGT AGCACCCGGTACAAGCAG
stb Heat-stable enterotoxin IIAJ555214.1ETECAbbotstown (22) GAGATGGTACTGCTGGAGCATGCT TTGCTGCAACCATTATTTGGG
stx1A Shiga toxin 1 A subunitAB035142.1STECEDL933 (19) GTGACAGTAGCTATACCACGTTACAGC TCTGCATCCCCGTACGAC
stx2A Shiga toxin 2 A subunitAB035143.1STECEDL933 (19) GCAGTTATACCACTCTGCAACGTGTC CtgAttTGCATtCCgGaACG
virF VirF transcriptional activator, ipaBCD-positive regulatorAF386526.1 Shigella flexneri NCTC8192 (HPA)** GCCTTTTATCAGCTGTTTCTGATGAGGA GAGAAGAAGCTATCGATATCGAAGT
rrl_0101_0177_1023S rRNA (large rRNA)M25458.1AllE2348/69d GTGTGTTTCGACACACTATCATTAACTGA GGTTCGCCTCATTAACCTATGG
rrl_0101_0177_2023S rRNA (large rRNA)M25458.1AllE2348/69d GTGTGATTCGTCACACTATCATTAACTGA
rrl_0260_0330_1023S rRNA (large rRNA)M25458.1AllE2348/69d CAGAGCCTGAATCAGTATGTGTGTTAGT GCCTTTCCAGACGCTTCC
rrl_0260_0330_2023S rRNA (large rRNA)M25458.1AllE2348/69d GAGCCTGAATCAGTGTGTGTGTTAGT
rrl_0260_0330_3023S rRNA (large rRNA)M25458.1AllE2348/69d AGAGCCTGAATCAGTTTGTGTGTTAGT
rrl_0520_0580_1023S rRNA (large rRNA)M25458.1AllE2348/69d GCAGTGGGAGCACGCTTAGG AAGGTACGCAGTCACACG
rrl_0520_0580_2023S rRNA (large rRNA)M25458.1AllE2348/69d AAGCAGTGGGAGCATGCTTAGG
rrl_1480_1560_coli_1023S rRNA (large rRNA)M25458.1AllE2348/69d CCGGAAAATCAAGGATGAGGCGTG CACCGTAGTGCCTCGTCA
rrl_1480_1560_coli_2023S rRNA (large rRNA)M25458.1AllE2348/69d CGGAAAATCAAGGCTGAGGCGTG
rrl_1480_1560_coli_3023S rRNA (large rRNA)M25458.1AllE2348/69d GGAAAACCAAGGCTGAGGCGTG2
rrl_1480_1560_shig_4023S rRNA (large rRNA)M25458.1AllE2348/69d GGAAAATCAAGGCCGAGGCGTG
rrl_1690_1770_coli_1023S rRNA (large rRNA)M25458.1AllE2348/69d GCTGATATGTAGGTGAAGCGACTTGC CGACTGATTTCAGCTCCACG
rrl_1690_1770_freu_3023S rRNA (large rRNA)M25458.1AllE2348/69d CGCTGATATGTAGGTGAAGTGGTTTACT
rrl_1690_1770_shig_2023S rRNA (large rRNA)M25458.1AllE2348/69d GCTGATACGTAGGTGAAGCGACTTG
  • a All probes and primers present in the array representing genes or encompassing allelic variations are listed. The description for each gene, the accession number of the target gene used initially for probe/primer design, the pathotype associated with each gene, and the positive control strain are also given. Probes for the 23S rRNA gene (rrl) were included as a species marker, while the gad gene was included as an invariant positive control present in low copy number in all E. coli strains. *, uropathogenic E. coli, avian pathogenic E. coli, and neonatal meningitis E. coli have been classed together as extraintestinal pathogenic E. coli (ExPEC) for this study; **, Health Protection Agency, National Culture Typing Collection. Lowercase letters in sequences indicate sequence variability within the consensus region within which the probe or primer was designed.

  • b EAEC, enteroaggregative E. coli; ETEC, enterotoxigenic E. coli; EPEC, enteropathogenic E. coli; STEC, shigatoxigenic E. coli; EHEC, enterohemorrhagic E. coli; EIEC, enteroinvasive E. coli. “All” indicates all E. coli.

  • c Polymorphic genes where different control strains were found to bind to different probe sets or probes showed different signal intensities reflecting allelic variation that had not been distinguished by PCR (see the supplemental material for details).

  • d For details, see www.sanger.ac.uk .

  • e HPA, Health Protection Agency; VLA, Veterinary Laboratories Agency.