TABLE 3

Primers used for verification

Description of amplified regionForward sequence (5′→3′)Reverse sequence (5′→3′)
acrR SNP in LIMCTGTAAATTCACGAACATATGGCACTCAGATTCAGGGTTATTCGTTAGTG
Deleted 11-kb region in LIMTCTTATCATGCCTACAAACCACATCGTTTCTGATTTCATTTGTGGCAGAC
Deleted 4-kb region in LIMATCGATGATCTGAATACGTAGACCTCTCTGCTTTCTAATCTGAACGGTTA
Flanking regions of 11-kb deletion in LIMGTAATTCCGGTGATGAAAATGCTGCCACCACGGTAAGGATGATAATTTC
Flanking regions of 4-kb deletion in LIMATTGATCAACCTTTTCTACCGCTACCTTTGACGTGGTGATATGGATGAC
Flanking regions of 95-kb deletion in CARACGAATGATAAGGTATTCAAGGCAGGATCACAGCTTTCACGACCTTAATA
gyrB deletion in CITAGAAGTAGAAGATATTCGGGTGGATTATTCGAGGTGGTAGATAACGCTAT
Intergenic region between eptB and yhjX in CIT and deleted 95-kb region in CARAAATGCCTTTCCAGACGGTAAAATCTATGTGACCTTCTACGTGATTTTCG
marR insertion in CITAAGGGGTAAACAAGGATAAAGTGTCGATCCAGTCCAAAATGCTATGAATG
soxR SNP in CARTTCATCTGTTGGGGAGTATAATTCCATACTTTTACACTGGCGAAGAAACG