TABLE 2.

Primers used in this study

PrimerSequencea
upp_upFGCTTTTGACGTCGCATTGGATCCAAGTTTTGCTG
upp_upRAATCATCTCGAGTTTGTGTTGAATTAGCGGATGATC
upp_downFTAGATGGCATGCTCGAGGAAGACGGCTATATCGTTCCTG
upp_downRTTACTTACTAGTAGATCTGACAGCCACAAACAGGCGTTG
upp_upF_SphIGCTTTTGCATGCGCATTGGATCCAAGTTTTGCTG
PfwUPP_FATGGGAAAATTTCAAGTAATTGATCATC
PfwUPP_NcoRTTTTTTCCATGGATTCTTTTTCATAGCTCCTCCTTTG
Pfw_XbaFTCGACGTCTAGATCCTCGAGCTCTAGATCTTAAGC
Pfw_RGATGATCAATTACTTGAAATTTTCCCATATATATATCCTCCTCACTATTTTGATTAG
SrtA_upFTTGGAATCTAGAAATAACACCTTCTTGCAAGATACCTTTC
SrtA_upRTTTTTTCTGCAGTGGGCGCATATTTTCCCTCCTTTTAATG
SrtA_dnFCAAAAACTGCAGGCCGATTGGGTGGCTTAATAAAAAAATC
SrtA_dnRTCAGCACCCGGGAGCCACTGGGAAGTTGGCAGTCAG
3535_SrtAFAAATAGGCATGCCAAATAAATTGTGGTAAACTTGATACATT
3535_SrtARTTTTGCTCTAGAGAAACAGCAAGAACGCCAAGTGATG
3535_uppFTTAGGAACTAGTGAATTCAACTTGTGTCCTAGGCTC
3535_uppRACCGTTTCTAGACATAATCGGTTACCTAACGGTT
upp_oupGTGGCCCATTGGAACATGTGATTGC
upp_odnAGGATTTCGCCGTTGACACCCATG
srtA_oupCTTGCTAAGTGAATCTTCCACCAAG
srtA_odnCGTCAGAAAGTCCAACAAGCCGGT
BrbsAACTGCAGATCGAGGAGAATGATACATGAATC
PrgB10466 revTTATTTTGTTTCTTTTCTACGTTTA
  • a Restriction sites used for cloning of PCR amplicons are indicated in boldface.