TABLE 1.

Primer sequences for cloning and expression

GenePrimerSequencea
lnpBCloning forwardGCGACCAACGATTATGGCAAGGGC
Cloning reverseGGCGTATACCTCGGTCAGCTGATCGCTCAT
Expression forwardAACGGACCCCATATGACCGAAAGCAATGAAGTTTTATTC
Expression reverseGCTGACCTCGAGCCTGGCAGCCTCCATGATGTCGGCTAC
lnpCCloning forwardCATCGTAGCCGACATCATGGAGGCTGCC
Cloning reverseCCCGTAACCAGGACAGTGGTCATGTTTCC
Expression forwardGATATATACATATGAACGATCAGCTGACCGAGGTA
Expression reverseTGACCTCTCGAGCCTAGCGGCAAAACCAAGGCTTTCGA
lnpDCloning forwardGGCAACACGGCCGTCTTCAAGCAGAAAGC
Cloning reverseGGCAACACGGCCGTCTTCAAGCAGAAAGC
Expression forwardGATATACATATGACTACTGTTCTGGTTACGGGC
Expression reverseCTGCTCCTCGAGCTCCGCGTCGCGGAAACCGTTGGGGTTC
  • a Restriction endonuclease sites are underlined.