TABLE 1.

Primers used in this study

Target category and primerSequence (5′ to 3′)TargetReference or GenBank accession no.
Integrons
    5′-CSGGCATCCAAGCAGCAAGClass 1 integron14
    3′-CSAAGCAGACTTGACCTGA
    hep74CGGGATCCCGGACGGCATGCACGATTTGTAClass 2 integron31
    hep51GATGCCATCGCAAGTACGAG
    IntI2-F2GATCCTGCCATCATTGAGTAWithin class 2 integron1
    IntI2-R2AGGGGAAGCCGAAGTTTCC
β-Lactamases
    TEM-FATAAAATTCTTGAAGACGAAAblaTEM1
    TEM-RGACAGTTACCAATGCTTAATC
    SHV-FTTATCTCCCTGTTAGCCACCblaSHV1
    SHV-RGATTTGCTGATTTCGCTCGG
    SHV-F-2CGGCCTTCACTCAAGGATGTAWhole blaSHVDQ247972
    SHV-R-2GTGCTGCGGGCCGGATAAC
    OXA-FTCAACTTTCAAGATCGCAblaOXA1
    OXA-RGTGTGTTTAGAATGGTGA
    CTX-M-FCGCTTTGCGATGTGCAGblaCTX-M1
    CTX-M-RACCGCGATATCGTTGGT
    CTX-M-F2CCAGAATAAGGAATCCCATGWhole blaCTX-MNC_004464
    CTX-M-R2GCCGTCTAAGGCGATAAAC
    CMY-FGACAGCCTCTTTCTCCACAblaCMY33
    CMY-RTGGAACGAAGGCTACGTA
    CMY-F2ACGGAACTGATTTCATGATGWhole blaCMYAY899928
    CMY-R2GAAAGGAGGCCCAATATCCT
    Oxy-FGGTTTTGGTAACTGTGACGGGblaOXY10
    Oxy-RCAGAGTGCAGAGTGTTGCAG
    Oxy-F2GGCAATCCAGCCGGGGCCAAWhole blaOXYZ30177
    Oxy-R2CGGGCCTGTTCCCGGGTTAA
Plasmid-mediated quinolone resistance genes
    qnrA-FATTTCTCACGCCAGGATTTGqnrA27
    qnrA-RGATCGGCAAAGGTTAGGTCA
    qnrB-FGATCGTGAAAGCCAGAAAGGqnrB27
    qnrB-RACGATGCCTGGTAGTTGTCC
    qnrS-FACGACATTCGTCAACTGCAAqnrS27
    qnrS-RTAAATTGGCACCCTGTAGGC
    aac(6′)-Ib-FTTGCGATGCTCTATGAGTGGCTAaac(6′)-Ib22
    aac(6′)-Ib-RCTCGAATGCCTGGCGTGTTT