TABLE 1.

Oligonucleotide primers used in this study

PrimerSequence (5′ to 3′)PurposePosition in accession no. AY131335 sequence
CphAIfATGACGACCCGTCAAGTAGCExpression of cphA-I8415-8434
CphAIrCTTCAGATCAGGATTAGGAGCAAExpression of cphA-I9326-9304
CphAIIfATGTCGGGAATCATCCATGCCExpression of cphA-II12394-12374
CphAIIrTGCGAGGGCGGGGGCGAGGAExpression of cphA-II11486-11505
P1CTGAAACAACTCATGCAAGCCCTAnneal to conserved region of hydroxyquionol dioxygenase gene8523-8545
P2GGAGCGAGAACGATATCGAAAnneal to conserved region of hydroxyquionol dioxygenase gene9310-9291
P3TGGAACGGACRandom primer5652-5661
P4GCGATGGTCTAnneal to clone c18707-8698
P5AGTGCGCTGCRandom primer2181-2190
P6CCGAAGTGGTAnneal to clone c25981-5972
P7GATCGTCAGCRandom primer−9-0
P8GGCATCGTTAAnneal to clone c32405-2396
P9GTCCAGGGTGACCCTTATATAnneal to clone c19147-9166
P10aTGCACCACAAGATNTGYCAAnneal to conserved region of maleylacetate reductase12832-12814
P11CGGTTCAGGAAnneal to clone c613555-13564
P12ATCACGAGGGRandom primer15017-15008
P13TGCCCTACGAAnneal to clone c714653-14662
P14CAGCCGACGTRandom primer15476-15485
CmxFAGCATGTAGAGGGCAAAAGGAnneal to internal fragment of Tn 1409NAb
Tnp2AGAAGACGTGCTGGCGTACTTCGAAnneal to internal fragment of Tn1409NA
Tra1GCTGATAGGCGAACGCAACTGGTCScreen cph cluster for transposon insertion315-338
Tra2GTCGCGAACTGAACCGCTAACTCGScreen cph cluster for transposon insertion7500-7477
Tra3CACCGCGAGTTTGCTGCGAATTATScreen cph cluster for transposon insertion7042-7065
Tra4TCTGGCACCTTACGGCCAATTCACScreen cph cluster for transposon insertion13842-13819
  • a Degenerate primer.

  • b NA, not applicable.