TABLE 1.

Primers used to generate probes for toxin genes and toxin regulators

PrimerSequence (5′-3′)aTarget geneProbe size (bp)
LCF-139TTAATTAATTTTCTCTACAGCTATCCtcdC722
LCF-140TCTAATAAAAGGGAGATTGTATTATG
LCF-149TGAACCTGGAAAAGGTGATGcdtA376
LCF-150AGGATTATTTACTGGACCATTTG
LCF-160TGGTGATATGGAGGCATCACCACTtcdB501
LCF-161TGAGCTTTAGCTCTTGCATCGTCA
LCF-162ACATTATGAAGAGGGAGAAACAGAtcdR385
LCF-163AGCCTTATTAACAGCTTGTCT
LCF-164CCTAGGAGGCGTTATGAATATGACAtcdE366
LCF-165GGTACTGGTAATCCACATAAGCAC
LCF-166AGCTCTATTGGACTAGACCGTTGGGAtcdA514
LCF-167ACGCATAAGCTCCTGGACCACTTA
  • a Most sequences were based on the genomic sequence of C. difficile strain CD630 (accession number NC_009089); the exceptions were primers LCF-149 and LCF-150, which were based on the genomic sequence of C. difficile strain QCD-32g58 (accession number AAML00000000).