TABLE 1.

16S rRNA PCR primer sets used for real-time PCR in this study

BacteriumForward sequence (5′-3′)PositionReverse sequence (5′-3′)PositionProduct length (bp)ToCaReference
Desulfovibrio genusCCGTAGATATCTGGAGGAACATCAG691ACATCTAGCATCCATCGTTTACAGC82613562 10
Faecalibacterium prausnitzii GATGGCCTCGCGTCCGATTAGb223CCGAAGACCTTCTTCCTCC42019958 47
Clostridium clostridioforme AATCTTGATTGACTGAGTGGCGGAC99CCATCTCACACTACCGGAGTTTTTC24714862 5
Peptostreptococcus anaerobius GCTCGGTGCCTTCACTAACGb1310AGCCCCGAAGGGAAGGTGTG149818864 41
LactobacillicGATAGAGGTAGTAACTGGCCTTTA478GCGGAAACCTCCCAACA85339055 32
BifidobacteriaAGGGTTCGATTCTGGCTCAG8CATCCGGCATTACCACCCb16415662 19
BacteroidesGTCAGTTGTGAAAGTTTGCb605CAATCGGAGTTCTTCGTG73212756 6
EnterobacteriaCATTGACGTTACCCGCAGAAGAAGC457CTCTACGAGACTCAAGCTTGC65219563 5
Eubacterium rectale CGGTACCTGACTAAGAAGC477CCTAGTATTCATCGTTTACGGCGTGb82534760 42
Enterococcus faecalis GCTTTCGGGTGTCGCTGATG199CGTCCTTGTTCTTCTCTAAC45225358 5
All eubacteriaACTCCTACGGGAGGCAGCAGT330GTATTACCGCGGCTGCTGGCAC53020054 39
  • a ToC indicates the optimum melting temperature determined by conventional temperature gradient PCR.

  • b Primer modified from primer in reference.

  • c Lactobacillus primers were determined by sequencing and experimental tests to detect bacterial subgroups associated with L. delbrueckii and L. plantarum, which include L. acidophilus, L. crispatus, L. johnsonii, L. gasseri, and L. brevis.