TABLE 1.

Primer sequences for the macroarray

GenePrimers (5′-3′)Product size (bp)
oxyR ATCGCCGCCAAGAGGTGCTA311
TCACGCACTGCACGACGGT
katG TGTCCCGTCGTGGGTCATAT370
TTGTCCAAGCTGGCGTTGT
rpoB TGCGTGTGTATGTGGCTCAGAAA159
CGCCGTGGGTGTTCAAAATAAT
rpoB GTAAGGCGCAGTTCGGTGG203
TTTGAGCAGCACCTTGAACGA