TABLE 1.

Primer sequences for the macroarray

GenePrimers (5′-3′)Product size (bp)
oxyRATCGCCGCCAAGAGGTGCTA311
TCACGCACTGCACGACGGT
katGTGTCCCGTCGTGGGTCATAT370
TTGTCCAAGCTGGCGTTGT
rpoBTGCGTGTGTATGTGGCTCAGAAA159
CGCCGTGGGTGTTCAAAATAAT
rpoBGTAAGGCGCAGTTCGGTGG203
TTTGAGCAGCACCTTGAACGA