TABLE 1.

PCR primers used in this study

PrimerSequence (5′-3′)aAdded restriction siteDesignationGenBank accession no. of target gene
1GCGGATCCGCATGAGTGATCTAGACAGACTTBamHIlinA1 and linA2 senseAY150579, AY150580
2GCCTCGAGTCACGATTTTTGCAACAGAGCXhoIlinA1 antisenseAY150579
3GCCTCGAGTTATGCGCCGGACGGTGCGAAATGXhoIlinA2 antisenseAY150580
  • a Added restriction sites are underlined.