TABLE 1.

Specific primer sequences designed for KB1 RDH genes

KB1 gene targetPrimer nameaSequence (5′-3′)
rdhA1rdhA1_246fATCGGAGCTGCACAAGTAGG
rdhA1_336rTCTTGTGAGCGGTGTCTTTG
rdhA2rdhA2_720fCAAAGGAGATGTTCCGGTGT
rdhA2_985fCAGGTGGAAAAGACCGGTTA
rdhA3rdhA3_1149fCATTCTCCGGGAAGAAAACA
rdhA3_1379rCCAGGCTTCCTTGTCTTCAG
rdhA4rdhA4_754fTTGTTATGCCGCCAATATGA
rdhA4_925rTCTATCCATTTCGCCCAGAC
rdhA5rdhA5_1017fGATGCAGGCATTTACCGTTT
rdhA5_1137rGTCTCTTTGCCTTCGGTCAG
rdhA6rdhA6_318fATTTAGCGTGGGCAAAACAG
rdhA6_555rCCTTCCCACCTTGGGTATTT
rdhA7rdhA7_1391fGCTAAAGAGCCGTCATCCTG
rdhA7_1539rGCAGTAACAACAGCCCCAAT
rdhA8rdhA8_845fCCCAAGGTAGGTGTGCAGAT
rdhA8_1016rCCCGGTTAGTTACCCCGTAT
rdhA9rdhA9_251fCTGACCTTGAAACCCCTGAA
rdhA9_425rTTGCCACCCATTTCCATATT
rdhA10rdhA10_710fGCTGAAACACCCACCAAACT
rdhA10_860rCGACAAAGGGGAATCTTTGA
rdhA11rdhA11_429fTAATGGCAACCGGAGGTAAG
rdhA11_609rTCTACCGGTATGGCCTGAAC
rdhA12rdhA12_864fAGGAGTTCCTGTGGGGACTT
rdhA12_994rTTTGGGGGTCATAACTGCTC
rdhA13rdhA13_1356fCAGGGTACCTGTCCCTTCAA
rdhA13_1493rAGGGTTCTTCCGTCCGTACT
rdhA14rdhA14_642fGAAAGCTCAGCCGATGACTC
rdhA14_846rTGGTTGAGGTAGGGTGAAGG
  • a The position numbers are shown within the names with respect to the first nucleotide of each gene following the RRF2 primer binding site. f, forward; r, reverse.