TABLE 2.

Primers used in this study

PrimerSequence (5′ to 3′)aUse
EH079NNNGTCGACGAGTGATCTACTTGGATGΔcpxR1 mutant construction
EH078NNNTCTAGAGCATTAATTCTTCCTCCAAGΔcpxR1 mutant construction; creation of cpxRp-lacZ fusion
EH080NNNGAGCTCGTAAAATGATCAATAGCCΔcpxR1 mutant construction
EH081NNNCCCGGGCGTTTCAACAATCGCTAATCΔcpxR1 mutant construction
EH146TAAATTTCTCCGCTTTCTCGAATAGCΔcpxR1 mutant complementation; creation of cpxRp-lacZ fusion
EH121GTCTAGAAATTTGGCTTATCCTCTTAGΔcpxR1 mutant complementation
EH145ACGCTTAACACCGTTTGATCGRT-PCR for cpxRA cotranscription
EH013CATTAAATATCCACGACCACGRT-PCR for cpxRA cotranscription
EH014TTCTGGACAGTGAGTATCAGCRT-PCR for cpxRA cotranscription
EH015CACTGGTAACAAGGAGTAAGCRT-PCR for cpxRA cotranscription
recAminForTGTCCGTTTGGATATCCGCCqPCR (recA)
recAminRevCCCAGAGTATTAATACCTTCCCCAqPCR (recA)
EH102CGCAGATGACTATCTCCCTAAACCqPCR (cpxR)
EH025CCGTCAAAACTGGCCTCCqPCR (cpxR)
EH014TTCTGGACAGTGAGTATCAGCqPCR (cpxA)
EH015CACTGGTAACAAGGAGTAAGCqPCR (cpxA)
EH147GCCAGCAGATGTGGGATTTAGqPCR (cpxP)
EH103CTCAAGTTGCAGCCGAACCqPCR (cpxP)
lrhAintCFCGCTGGAAACGCTGGATATqPCR (lrhA)
lrhAintCRGGCAGACGTGGTAATCCTTqPCR (lrhA)
xlpAintFCGCTGCATTGGCAACAGGAAAqPCR (xlpA)
xlpAintRGCCAATCGTGCTGAACGGTATqPCR (xlpA)
EH035GCGGAGCACTATAGTTAAATGTGqPCR (flgE)
EH036CAACGGCGAAATTCAGATAGGCqPCR (flgE)
flhDintFGCGATGTTCCGTTTAGGTAqPCR (flhD)
flhDintRGCGATTCCTTCGTTAACTGqPCR (flhD)
fliAintFGGCACGAAATTCACGGTGAAqPCR (fliA)
fliAintRCCGTTCAGGCAATGACTCAAqPCR (fliA)
fliCintFGCGAACGTTAAAGGCCTGACTqPCR (fliC)
fliCintRGCCGTTGAACTGAGTTTGTGTqPCR (fliC)
prot 1TCTTGGTCTGATGTTGCCqPCR (prtA)
prot 2ACCCTGAGGCAGATTTGCqPCR (prtA)
xhlBquant1GCTAAAGGCTATATTACGGCGqPCR (xhlB)
xhlBquant2GCTGATTCAGGTTGAGTGGCTqPCR (xhlB)
EH124CTGATAAGCAGCTGGCTGqPCR (xaxA)
EH125CCATCTGATAACTCACCGCCqPCR (xaxA)
EH068CTATGCCAGGCTTATTAGCGCqPCR (mrxA)
EH069CGATGGCGGTAAATTCACCCqPCR (mrxA)
  • a Engineered restiction enzyme sites are underlined. N = G, A, T, or C.