TABLE 2.

Oligonucleotides used in this study

Primer (description)aOligonucleotide sequence (5′-3′)bRestriction site
pIMK
    IM203 (MCS T3 FWD)AATTAACCCTCACTAAAGGGAAC
    IM204 (MCS T7 REV)GACGTCGTAATACGACTCACTATAGGGCAatII
    IM205 (T7/1,100 bp O FWD)AGTGAGTCGTATTACGACGTCCCAGGGCTTCCCGGTATCAACAatII
    IM211 (4,585 bp REV)CATATGATCATCATAATTCTGTCTCATTATATAACNdeI
    IM207 (Kan FWD)ATAAACCCAGCGAACCATTTGAGGTGATAGG
    IM208 (4,585 bp/Kan O FWD)ATAATGAGACAGAATTATGATGATCATATGAAACATCAGAGTATGGNdeI
pIMK2, pIMK3, and pIMK4
    IM236 (Phelp FWD)ATATGAGCTCCATTATGCTTTGGCAGTTTATTCTTGACATSacI
    IM214 (tiling FWD1)GAATACCATAATTCCAATAGATATGAGCTCCATTATGCTTSacI
    IM215 (tiling FWD2)TGGCAGTTTATTCTTGACATGTAGTGAGGGGGCTGGTATA
    IM216 (tiling FWD3)ATCACATAAATTGTGAGCGCTCACAATTATAAAGCAAGCA
    IM217 (tiling FWD4)TATAATATTGCGTTTCATCTTTAGAAGCGAATTTCGCCAA
    IM218 (tiling FWD5)TATTATAATTATCAAAAGAGAGGGGTGGCAAACGGTATTT
    IM219 (tiling FWD6)GGCATTATTAGGTTAAAAAATGTAGAAGGAGAGTGAAACC
    IM220 (tiling REV1)TATATGGATCCTTTTCCATGGGTTTCACTCTCCTTCTACABamHI/NcoI
    IM221 (tiling REV2)TTTTTTAACCTAATAATGCCAAATACCGTTTGCCACCCCT
    IM222 (tiling REV3)CTCTTTTGATAATTATAATATTGGCGAAATTCGCTTCTAA
    IM223 (tiling REV4)AGATGAAACGCAATATTATATGCTTGCTTTATAATTGTGA
    IM224 (tiling REV5)GCGCTCACAATTTATGTGATTATACCAGCCCCCTCACTAC
    IM225 (tiling REV6)ATGTCAAGAATAAACTGCCAAAGCATAATGGAGCTCATAT
    IM327 (OID2 FWD)ATATGAGCTCAATTGTGAGCGCTCACAATTCSacI
    IM200 (Phelp FWD)AGATGTCGACGATCCCATTATGCTTTGGCSalI
    IM201 (lacI REV)TATAGGTACCTTACTGCCCGCTTTCCAGTCGGKpnI
    IM202 (Phelp/lacI O FWD)ATGTAGAAGGAGAGTGAAACCCATGAAACCAGTAACGTTATACGATGTCG
    IM212 (rrnB TT FWD)ATATGACGTCGGGCCCTTTCGTCTTCAAGAATTAAAatII
    IM213 (rrnB TT REV)TCAAGAGCTCGAATTCCGATCCCCAATTCCSacI
Deletion mutant
    IM463 (inlA-A FWD)AACGCCATGGAGGATATCACTAAACGGCTCCNcoI
    IM464 (inlA-B REV)CGTTGTAACTTGGTCTAGATCTGTTTGTG
    IM465 (inlA-C FWD)AGATCTAGACCAAGTTACAACGAAAGAAACAACCAAAGAAGTGGAAG
    IM466 (inlA-D REV)ATATCTGCAGCAAACGTTGCTGTATAGCTATTGGPstI
    IM467 (inlA-E out FWD)TATATAGGAAAAATGTGCTGGAACG
    IM468 (inlA-F out REV)TCCTTGATAGTCTACTGCTTGAGTCG
    IM330 (p60-A FWD)TATACTGCAGTTCTATTATAGAATACCATAAACTCATCPstI
    IM079 (p60-B REV)CATAAAACTCCTCTCTTTTTTCAGAAAATC
    IM331 (p60-C FWD)AAAAAAGAGAGGAGTTTTATGTAATTAATAACTTAAAGTAACCTGTGG
    IM332 (p60-D REV)TATATCTAGAAAGCCGTAGTAGAGTCATCTGCXbaI
    IM362 (p60-E out FWD)ACTATTTTTCGATCATCATAATTCTGTCTC
    IM363 (p60-F out REV)ATGCCTAGACTGTACCATTGAATTACG
    IM435 (prfA*145/148 FWD)TATACTGCAGTAGAAACTAACGGGATAAAACCPstI
    IM436 (prfA*145/148 REV)ATATTCTAGATTGCAGCTCTTCTTGGTGAAGCXbaI
    IM443 (prfA*71 FWD)TTAACTGCAGAATAAATCCGTTTTTAAATATGPstI
    IM444 (prfA*71 REV)TATATCTAGAATTTTTATACACGATAACTTTCTCXbaI
    IM447 (prfA*94 FWD)AATCCTGCAGGTAAAAAACATCATTTAGCGTGACPstI
    IM449 (prfA*94 REV)ACATTCTAGATAAAACCATTCATCTAATTTAGGXbaI
    IM457 (secA-A FWD)TATACTGCAGGAACAAAACAATTTTCATTGAAACCPstI
    IM458 (secA-B REV)CATTTAAATTCTCCTCTACTGTTTTCGC
    IM459 (secA-C FWD)ACAGTAGAGGAGAATTTAAATGTAGATTGAAACAATTTAAAAAGCGC
    IM460 (secA-D REV)TATACCATGGTTAATATCTTTTTCTAATTCTTCTTGNcoI
    IM152 (secA-E out FWD)AAAATGAAGGAGATTTTGATCTTGAAATTG
    IM153 (secA-E out REV)ATGCACTAATAGTCGCCATGTAAGC
Cloned genes
    IM319 (LuxA FWD)ATATCCATGGAATTTGGAAACTTTTTGCTTACATACCNcoI
    IM319a (LuxE REV)ATATCTGCAGGATATCAACTATCAAACGCTTCGPstI
    IM333 (p60 FWD)ATATCCATGGATATGAAAAAAGCAACTATCGNcoI
    IM334 (p60 REV)ATATGTCGACAAACCTGTGAAGCGAACTGCTTGCSalI
    IM194 (inlA FWD)ATATCCATGGGAAAAAAACGATATGTATGGTTGNcoI
    IM188 (inlA REV)TTTTCTGCAGTTATTTACTAGCACGTGCTTTTTTAGPstI
    IM461 (secA FWD)ATATCCATGGCTGGACTATTGAAAAAAATTTTTGNcoI
    IM462 (secA REV)ATATCTGCAGTTATGCTTCTTTACCATGACAATTTPstI
  • a FWD, forward; REV, reverse; TT, transcription terminators.

  • b Bold type indicates restriction sites.