TABLE 1.

qRT-PCR primer and probe sequences and labels

PrimerSequenceLabelaConcn (nM)Tempb (°C)Product size (bp)
Primers and probes for qRT-PCR
    gfp-ForTTTCACTGGAGTTGTCCCAATTC4006080
    gfp-RevCACCCTCTCCACTGACAGAAAAT400
    gfp-ProbeTGTGCCCATTAACATCACCATCTAATTCAACA5′ FAM, 3′ BHQ-1300
    acpP-ForACTCGGCGTGAAGGAAGAAG400c/50d6080
    acpP-RevCGACGGTGTCAAGGGAGT400c/900d
    acpP-ProbeAAGTCACCAACAGCGCTTC5′ JOE, 3′ BHQ-1200
    lucI-ForGTGTTGGGCGCGTTATTTATC2006078
    lucI-RevACTGTTGAGCAATTCACGTTCA200
    lucI-ProbeCGCCCGCGAACGACATTTAT5′ Cy5, 3′ BHQ-2200
    aprA-ForGCTTCAGCCAGAACCAGAAGAT2006078
    aprA-RevTCGACACATTGCCCTTCAAC200
    aprA-ProbeACATCGGACAGCGCCTTCTCGTTG5′ FAM, 3′ BHQ-1100
    phzA1-ForTAAAACGTAATCGCGAGTTCATG9006074
    phzA1-RevTTTTATTTGCGGAACGGCTATT900
    phzA1-ProbeCCAATGCACGCAGTTTCTGTATCGGGT5′ ROX, 3′ BHQ-2150
    16S rRNA-ForeCAAAACTACTGAGCTAGAGTACG30059215
    16S rRNA-ReveTAAGATCTCAAGGATCCCAACGGCT300
Primers used for IVT
    gfp-T7-forTAATACGACTCACTATAGGGGGAGAAGAACTTTTCACTGG
    gfp-T7-revGAAAGGGCAGATTGTGTGGAC
    acpP-T7-forTAATACGACTCACTATAGGGCCATCGAAGAACGCGTTAAG
    acpP-T7-revCCTGAACGGTGGTGATCTTT
    aprA-T7-forTAATACGACTCACTATAGGGCTTGCATTGAAAGGTCGTAGC
    aprA-T7-revGATATCGCCGTAGACGAAGGT
    phzA1-T7-forTAATACGACTCACTATAGGGGTCAGCGGTACAGGGAAACAC
    phzA1-T7-revGTGGGAATACCGTCACGTTT
  • a FAM, 6-carboxyfluorescein; BHQ-1, black hole quencher 1; JOE, carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein; and ROX, carboxy-X-rhodamine.

  • b Annealing temperature for PCR.

  • c Primer concentrations used in acpP, gfp, and lucI triplex reactions.

  • d Primer concentrations used in acpP, aprA, and phzA1 triplex reactions.

  • e Primers sequences used by Matsuda et al. (31). The acquisition step of the 16S rRNA assay was performed at 72°C.