TABLE 1.

Primers used in this study

Primer nameTarget geneSequencea
CL1egfpCATATGGGAGGCGGAGGCGGTGGCGGAGGTGGCGGAGTGAGCAAGGGCGAGGAG
CL2egfpGTGGATCCTTACTTGTACAGCTCGTC
CL3mamGCTCGAGGGAGATCAGATGATCAAGGGCATC
CL4mamGCATATGAGCAGGCTCGGCGGAGGC
CL5mamFCTCGAGAGGGCAAAGCAATGGCCGAGAC
CL6mamFCATATGGATCAGGGCGACTACATGGCTG
CL7mamCCTCGAGAGGACAACAGCGATGAGCTTTC
CL8mamCCATATGGGCCAATTCTTCCCTCAG
  • a Restriction sites that were incorporated into the primer are indicated in boldface, and the sequence region encoding the glycine-linker is in italics.