TABLE 2.

Oligonucleotide primers used in this study

PurposePrimerSequencea
Cloning of α-amylase fragment of apuB in pNZ8048ApuAfTGCATCCCATGGCCCATCACCATCACCATCACCATCACCATCACACCGAGGCCAATGCACAG
ApuArCTCGAATCTAGATTAGTAGGAGTCCTCGCCGGTG
Cloning of pullulanase-encoding fragment of apuB in pNZ8048ApuPfTGCACGCCATGGCCCATCACCATCACCATCACCATCACCATCACGCCGACACGAGCCGCACCATC
ApuPrTGCGCATCTAGACTACTGTTCGGAGCCCTC
Cloning of internal fragment of apuBApuBfCTTGCGAAGCTTGGCGGCGACGGCTGGGTGAG
    in pORI19ApuBrGCGACGTCTAGACCTTCGGCGGGCTTGTAGTGC
Amplification of 5.1-kb apuBApuFATGGCCGTACGACGATTCAGCTC
    fragment for use as probe in Southern hybridizationApuRCTGTTCGGAGCCCTCCTTACTG
Colony PCR primer pairApu1ATCGCCATCGCATTCCAAACCAAC
pORI19rGATTAAGTTGGGTAAGCCG
  • a The sequences in bold correspond to restriction sites.