TABLE 2

Oligonucleotides used in this work

Primer name (target)Sequence (5′–3′)Reference or source
RNMS003AGGGATGGGTGACATCACAGCGTTGTCGGAGGAGATTTTCATGATGATACGTGAGCAAATAGAAGAAAAAGTGTAGGCTGGAGCTGCTTCThis study
RNMS004AACATACTGGAAAAGCGGAGGTAGTTGCAAATCCGTTTTGCTACGCGATGCTTCCCGCGCCGCGACAAGGCATATGAATATCCTCCTTAGThis study
RNMS011GCTCTAGAGCGTCAACTCTACTCCGCAAGCACThis study
RNMS012AAAGGTACCTTTGTGGTCAACGCAGGTAAATTCGThis study
P1RT (gallerimycin)CGCAATATCATTGGCCTTCT48
P2RT (gallerimycin)CCTGCAGTTAGCAATGCAC48
P1RT (IMPI)AGATGGCTATGCAAGGGATG48
P2RT (IMPI)AGGACCTGTGCAGCATTTCT48
P1RT (lysozyme)TCCCAACTCTTGACCGACGA48
P2RT (lysozyme)AGTGGTTGCGCCATCCATAC48
P1RT (actin)ATCCTCACCCTGAAGTACCC48
P2RT (actin)CCACACGCAGCTCATTGTA48
P1RT (galliomycin)TCGTATCGTCACCGCAAAATG49
P2RT (galliomycin)GCCGCAATGACCACCTTTATA49