TABLE 1.

Strains, plasmids, and oligonucleotide primers used in this study

Strain, plasmid, or primerRelevant phenotype and description or sequence (5′ to 3′)aSource or reference
Strains
    Escherichia coli
        VE7108Kanamycin resistance marker; containing the wild-type repA plasmid gene (not thermosensitive); host for pG+host9 DNA manipulation9
        VE6838Kanamycin resistance marker; VE7108 carrying pG+host99
    Lactobacillus plantarum
        WTNCIMB 8826 wild-type strainNCIMB
        ΔldhL1NCIMB 8826 ΔldhL1 strain12
        ΔldhL1xpk1NCIMB 8826 ΔldhL1 Δxpk1 strainThis study
        ΔldhL1-xpk1::tktNCIMB 8826 ΔldhL1 strain with xpk1 gene replaced with tktThis study
Plasmids
    pG+host9Thermosensitive replicon; erythromycin resistance marker8
    pGh9-Δxpk1Vector for deletion of xpk1 gene of ΔldhL1; erythromycin resistance markerThis study
    pGh9-xpk1::tktVector for replacement of xpk1 gene of ΔldhL1 with tkt; erythromycin resistance markerThis study
Oligonucleotide primers
    xpk1-up_FCCGCTCGAGGCTGCTGGTCATTCGGAATT
    xpk1-up_RAACGAGCTCGTCGACAGATCTTTCAAAAACACTCCTTAATTTGCTTTTC
    xpk1-down_FACGCGTCGACGAGCTCGCAGTTAAAATCTTAATTTGAAAATAGCGT
    xpk1-down_RGTGGCGGCCGCATGAGCTTGCATGGTCGG
    xpk1-up_seqAAGCACTGAACTGGTTGCC
    xpk1-down_seqATAATTAAAAACCAATTAAAATATGCTCACAATTC
    tkt_FGGAAGATCTATGTTTGATACTACTGATCAATTGGCTG
    tkt_RACGCGTCGACTTAGTCAAGCTCTTTGTATGCTTTAACTA
  • a For primers, restriction enzyme sites are underlined.