TABLE 2.

Primer sequences and targets used to amplify 16S ribosomal DNA of Clostridium groups and for TTGE analysis

SpecificityaNameSequence (5′-3′)bProduct size (kb)Annealing temp (°C)Reference
Clostridium cluster IS-∗-Chis-0150-a-S-23AAAGGRAGATTAATACCGCATAA0.82654
S-∗-Cbot-0983-a-A-21CARGRGATGTCAAGYCYAGGTThis study
Clostridium cluster IIIS-∗-Cther-0650-a-S-23TCTTGAGTGYYGGAGAGGAAAGC0.7260This study
S-∗-Cther-1352-a-A-19GRCAGTATDCTGACCTRCCThis study
Clostridium cluster IVS-∗-Clos-0561-a-S-17TTACTGGGTGTAAAGGG0.5860This study
S-∗-Clept-1129-a-A-17TAGAGTGCTCTTGCGTAThis study
Clostridium cluster XIVabS-∗-Erec-0482-a-S-19CGGTACYTGACTAAGAAGC0.62554
S-∗-Ccoc-1112-a-A-19TGGCTACTRDRVAYARGGGThis study
Bacteria (TTGE-1)S-D-Bact-0907-a-S-20AAACTCAAAGGAATTGACGG0.31607
S-D-Grps-1097-a-A-20(GC-clamp)c-ACATAAGGGGCATGATGATT5
Bacteria (TTGE-2)S-D-Bact-0786-a-S-20(GC-clamp)-GATTAGATACCCTGGTAGTC0.306216
S-D-Bact-1060-a-A-21TCACGACACGAGCTGACGACA16
  • a Clusters as defined by Collins et al. (3).

  • b Y, T/C; V, G/C/A; R, A/G.

  • c GC-clamp, CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC.