TABLE 1.

Oligonucleotides used for construction of tlp mutants of C. jejuni NCTC11168

MutationFragment amplifiedaOligonucleotide sequences usedb
Δtlp1Fragment 15′ CGCGGATCCAATTTCGCTGCTCAGCCTGC, 5′ GCACTGATAAGTCAATCAAATTGCTGCGGC
Cmr gene insertion in tlp15′ TTTGATTGACTTATCAGTGCGACAAACTGG, 5′ GTTGTTATTGTCGGCGGTGTTCCTTTCCAAG
Fragment 25′ ACACCGCCGACAATAACAACAACAGCTGCC, 5′ CGCGGATCCAAATTAGATTGTGGTACGGC
Δtlp2Fragment 15′ CGCGGATCCGTCCAAGAAGGATGATAAAC, 5′ ACACCGCCGATTATCAAACACACTACTGCG
Cmr gene insertion in tlp25′ TGTTTGATAATCGGCGGTGTTCCTTTCCAAG, 5′ TTACTGTACTTTATCAGTGCGACAAACTGG
Fragment 25′ GCACTGATAAAGTACAGTAAGTGATATAGCTAAT, 5′ CGCGGATCCAGGTGTTTGTCCATTTGCAC
Δtlp3Fragment 15′ CGCGGATCCGTTTGTGATCTACAAGAGCTC, 5′ ACACCGCCGATTGCAATGAGGGAAAGTTTG
Cmr gene insertion in tlp35′ CTCATTGCAATCGGCGGTGTTCCTTTCCAAG, 5′ AGCTACGCTATTATCAGTGCGACAAACTGG
Fragment 25′ GCACTGATAATAGCGTAGCTCAAATTGATC, 5′ CGCGGATCCCTAATGTTGAACAAGCACTTG
ΔdocBFragment 15′ CGCGGATCCTCTCCATTTAGTTCAGCTTC, 5′ GCACTGATAAGTGAAATCAATAATATCTCTC
Cmr gene insertion in docB5′ TTGATTTCACTTATCAGTGCGACAAACTGG, 5′ TTTAGCTTTCTCGGCGGTGTTCCTTTCCAAG
Fragment 25′ ACACCGCCGAGAAAGCTAAAACTAGTGTAG, 5′ CGCGGATCCCAATACTTGCCATAGGCTTG
ΔdocCFragment 15′ CGCGGATCCCAGTTTCTTTAGAAGCTGTG, 5′ GCACTGATAAAGTACAGTAAGTGATATAGC
Cmr gene insertion in docC5′ TTACTGTACTTTATCAGTGCGACAAACTGG, 5′ TGGAATTTTATCGGCGGTGTTCCTTTCCAAG
Fragment 25′ ACACCGCCGATAAAATTCCAACCCATAGCG, 5′ CGCGGATCCATATTGTGTATAGCCACAGC
  • a For each tlp mutant, two fragments (1 and 2) containing the periphery of the tlp gene and ca. 1 kb of flanking sequences were amplified from C. jejuni NCTC11168. The tlp gene was then replaced by a Cmr resistance cassette inserted in between the two flanking fragments.

  • b Complementary oligonucleotide sequences used for splicing by overlap extension-PCR are indicated with italics.