TABLE 2.

Primers used for MLST analysis

PrimerSequence (5′-3′)Target genePCR product size (bp)Length (bp) of sequence usedReference
adk3GGGGAAAGGGACTCAGGCTCAGAdenylate kinase gene (adk)556462 7
adk4AACTTTCGCGTATTTGGTATT
arcA-p1GAAGACGAGTTGGTAACACGArcA respiration control protein gene (arcA)645544 7
arcA-p2NWCTTCCAGATCACCGCAGAAGC
arcA-p3CCATGAATCTGGGTACTGTCThis study
arcA-p4TGCCTGGGTTTTCACAGAAGThis study
mlp-p3CGTTGATCTGATTGCTCAGGMannitol-1-phosphate dehydrogenase gene (mtlD)580410 7
mlp-p4TGATCAGTACCGCACCACTT
mlp-3ACAAAGCGTGGGTAGAAGAACThis study
mlp-4ACCAGCGGATCGTTAGTTGCThis study
fumC-1CGGCTCCGGCACGCAAAGTAAFumarate dehydrogenase gene (fumC)753514 7
fumC-2ATCGCCACGTCGTTCCCCATCA
mdh+55CTGTTAAAAACCCAACTGCCMalate dehydrogenase gene (mdh)817496 7
mdh-872GCGTTCTGTTCAAATGCG
mdh+307CAGCAAGTTGCGAAAACCTGThis study
mdh+443CGCTGGATATCATTCGTTCThis study
mdh-441GGTAACGCCGAACAGTTTGThis study
mdh-544AGCGGCAGAATGGTAACACThis study