TABLE 1.

Primers used in extended MLST analysis

LocusSize (bp)PrimeraNucleotide position from start of locusbSize of product (bp)Annealing temp (°C)Primer reference or sourcec
Direction or nameeSequence (5′-3′)
adk645FATTCTGCTTGGCGCTCCGGG1058454UCC
RCCGTCAACTTTCGCGTATTT594UCC
arcA717FGACAGATGGCGCGGAAATGC9955258MSU
RTCCGGCGTAGATTCGAAATG651MSU
aroE819FGGGGGCGTTTAAATCCTTCA−6975958This study
RGCCTCGCTGCTCACACCA690This study
aspC1,191FGTTTCGTGCCGATGAACGTC5759458MSU
RAAACCCTGGTAAGCGAAGTC651MSU
clpX1,275FCTGGCGGTCGCGGTATACAA26267258MSU
RGACAACCGGCAGACGACCAA934MSU
cyaA2,547FCTCGTCCGTAGGGCAAAGTT31257158MSU
RAATCTCGCCGTCGTGCAAAC883MSU
dnaG1,746FCGCTGAACCCAATCGTCT76569658This study
RTCTCTGAATAAGCCAAGTCCA1461This study
fadD1,686FGCTGCCGCTGTATCACATTT76858058MSU
RGCGCAGGAATCCTTCTTCAT1348MSU
fumC1,404FTCACAGGTCGCCAGCGCTTCd1080654UCC
RGTACGCAGCGAAAAAGATTCd816UCC
grpE594FCCCGGAAGAAATTATCATGG3948858MSU
RTCTGCATAATGCCCAGTACG527MSU
gyrB2,415FGACGGGCGCGGCATTCC22068958This study
RCTGTAGCCTTCTTTGTCCA909This study
icdA1,251F1GCAACGTGGTGGCAGAC−4954158This study
R1TTCGATACCCGCATAAAT492This study
F2CTGCGCCAGGAACTGGATCT37166958MSU
R2ACCGTGGGTGGCTTCAAACA1020MSU
kdsA855FAAAAAGTGGTTAGCATTGG850258This study
RGCACCGCGATCGCAAAGAAT510This study
lysP1,470FCTTACGCCGTGAATTAAAGG3662858MSU
RGGTTCCCTGGAAAGAGAAGC664MSU
mdh939FGTCGATCTGAGCCATATCCCTAC13065058MSU
RTACTGACCGTCGCCTTCAAC780MSU
metG2,034FCACATCCAGGCTGATGTCTG8557358Johnson
RCATTTTATTTGCCACCTGCTC658This study
mtlD1,149FGCAGGTAATATCGGTCGTGG2265858MSU
RCGAGGTACGCGGTTATAGCAT680MSU
mutS2,562FGGCCTATACCCTGAACTACA168359658MSU
RGCATAAAGGCAATGGTGTC2279MSU
purA1,299FCGCGCTGATGAAAGAGATGA23481754UCC
RCATACGGTAAGCCACGCAGA1051UCC
recA1,062FCGCATTCGCTTTACCCTGACCd18573458UCC
RTCGTCGAAATCTACGGACCGGAd919UCC
rpoS993FCGCCGGATGATCGAGAGTAA27461858MSU
RGAGGCCAATTTCACGACCTA892MSU
torC1,173FTGAATGGGCGCGAATGAAAGA37563058This study
RGCGCCGTGGCACTGGTTACA1005This study
  • a Each primer pair targets conserved locations around the chromosome and was used to amplify loci in E. coli, E. albertii, E. fergusonii, and E. coli CI to CV isolates.

  • b The forward primer for aroE is located in the upstream flanking gene, yrdC. The forward primer for icdA is also located upstream but in the intergenic region between ymfC and icdA. Negative values indicate the upstream position relative to the start of the locus.

  • c UCC and MSU refer to publicly available online MLST databases at mlst.ucc.i.e.,/mlst/dbs/Ecoli (63) and www.shigatox.net, respectively. The metG locus was previously used in the J. Johnson laboratory (60).

  • d Primers are in the opposite orientation. They are listed here as they appear in the reference, but their position is relative to the start of the locus.

  • e F, forward; R, reverse.