TABLE 2.

PCR primer pairs and amplicon sizes of M. avium subsp. paratuberculosis ORFs used in this work

RegionORFaPrimers (5′-3′)bSize (bp)
vGI-10Pre-16S rRNA gene(F) TTGGCCATACCTAGCACTCC; (R) GCGCAGCGAGGTGAATTT97
vGI-1MAP0101(F) GGTTACCGACTTGGTCCAGA; (R) CCCGTCAGATCCATTACGAC238
cMAP0160(F) ATGCTTCGCGATACTTCCAA; (R) TGAGCACCTTGTTCAAATCG178
vGI-4MAP0859c(F) CCGGCGTACCTACAGACATT; (R) GAGCGATACAGGCGAAAGAC255
vGI-4MAP0865c(F) CCCGATAGCTTTCCTCTCCT; (R) GATCTCAGACAGTGGCAGGTG609
INDEL4MAP1435(F) TGATTGCGTTCACGTCGTC; (R) AACAGCGCATCGATCACATA265
MAP2729(F) GTGGCGGACAACGACTTC; (R) GATCTGCTCTCGCAGTTCG216
INDEL15MAP3584(F) GCGTTGGATCCTTTCGTG; (R) GTCCAGGCCGTCGAGATAG633
vGI-13MAP3746(F) ATGACAAGGACACCCGAAAG; (R) AGTGCAGAACTCACGCAATG239
INDEL12MAV_4125(F) TCACCTGTCCAGATCAACGA; (R) CGGGATCAGCTTGAGATACC303
INDEL12MAV_4126(F) GAACATGAACACCGAGGTCAC; (R) CACACGTACTCGTTGGCGTA306
  • a Annotations are from GenBank.

  • b F, forward; R, reverse.

  • c —, not associated with vGI or LSP.