TABLE 2.

Detailed information on the PCR-amplified region for sequences

Target nameTarget region positions (corresponding to GenBank accession no. AP008984)Target length (bp)Sequence of primer (5′→3′)Annealing temp (°C)
Forward primerReverse primer
GV-132171-32611441ACAAACAGATTCAGGCACCCTCGACTTTGACAAGCACCTG63
GV-482976-83201226TCACGGACGTGATCAACAATCGGCAATGTAGGTTCTGGTT60 or 63
GV-11210559-211058500GTATAACAGCCGCCACGAATCGCTGGAACCTACACTGTGA63
GV-12212073-212808736CCGCGGACTGGTACTATCATGACCAAAGCTCCATGTCGAT55 or 63
GV-13221081-221477397GACCTTGGACATGTAGGCGTCATGAGGCTACTCTGCCACA55 or 60
GV-14254153-254491339GTCAGCGTGCTTATGGGAATCTGGGAGTGTGCTGTCTTCA55