TABLE 1.

Primers and probes used in this study

Primer (P) or probe (S)Sequence (5′→3′)aTm (°C)b
P8807APCATTCTTGACAAGTTAACCAGTTAGCTG57
P8807AMCAAGGTTCTGCTGACATTCAAACA57
P100PAGGTTTAGCTCAGTTGGTAGAGCGC58
P3TTGGATGGAGGTTAGCGGACT56
PITSANFCGTAACAAGGTAGCCGTAC46
PITSENDCTCTGTGTGCCAAGGTATC45
PITSGCANFGTGATGTCTGAGTAATTTATTCTCAGGC56
PITSGCcGCCGCGCCCGCCGGCCGCCCGCGCGCCC GCCGCCGCGCCCGCCGCCGCCCGGCGG AATTATAAATATAGGAGCTCTCGCCGCAAC86d
S8807AR-TCTCCAGGGCAGCATTGAATCCAG-Q64
S100AR-CTTTGCAAGCAGGATGTCAGCGGTT-Q65
  • a The localization of the fluorescent dyes of the probes are indicated with R (reporter [FAM]) and Q (quencher [TAMRA]).

  • b Tm was calculated using PCRplan from PCGene version 6.7.

  • c AT sequence (underlined) was introduced between GC clamp and primer sequence to optimize melting behavior of fragments in DGGE (45).

  • d Tm was calculated using percent GC at 50 mM NaCl.