TABLE 2.

Genes and primers used for MLST

GeneEnzyme functionPositionaPrimerSequence (5′-3′)Amplicon size (bp)
gyrBGyrase, β subunit4101-6059gyrB-1CTTCGGTTGTTAATGCTTTGTC674
gyrB-2CAACTTGGTTTTTGTCTGCC
g6pdGlucose-6-phosphate dehydrogenase122134-123606g6pd-1TTATATGTCTGTTGCTCCTCGT669
g6pd-2CCGGTTCTGATGTAAAAAGG
pgmPhosphoglucomutase354671-356371pgm-1ATATCTGCCGAAGTGCTAAGAG654
pgm-2AGCAGCAATTTGATTTCCAG
ddld-Ala-d-Ala ligase634208-635341ddl-1GGGAATTCATCTGAACACGA675
ddl-2GATTGGGCTGGTAATGACAC
dnaEDNA polymerase III, α subunit934193-937075dnaE-1CGTATATAGAGCGCTTTGCC714
dnaE-2CGTTCTTATCGCGAGTTGTAC
purKPhosphoribosylamino-imidazole carboxylase1071235-1072353purK-1TGGTTATCATGTTGGTATTTTGG597
purK-2GAAGCAGGAGCATAGGAAAGA
rpoBRNA polymerase, β subunit1282812-1286405rpoB-1CGATATTCTCCTTTCTCCAATG665
rpoB-2CTTTAGCGATCTGTTCCAATG
recPTransketolase1393609-1395648recP-1AGCGACAAACCATCCTTTATC
recP-2CGACAGCTAAGGAATCATGAG676
  • a Numbers denote the positions of the first and last bases of the gene on the O. oeni PSU-I chromosome.