TABLE 1.

LAMP primers used for assays

Target geneGenBank accession no.PrimerSequence (5′ to 3′)
Cj0414a AL111168 CJ-FIPACAGCACCGCCACCTATAGT-AGAAGCTTTTTTAAACTAGGGC (F1c-F2)
CJ-BIPAGGCAGCAGAACTTACGCATT-GAGTTTGAAAAAACATTCTACCTCT (B1-B2c)
CJ-F3GCAAGACAATATTATTGATCGC (F3)
CJ-B3CTTTCACAGGCTGCACTT (B3c)
CJ-LFCTAGCTGCTACTACAGAACCAC (LFc)
CJ-LBCATCAAGCTTCACAAGGAAA (LB)
CCO0367b AAFL01000003 CC-FIPAAGAGATAAACACCATGATCCCAG-TCATGAATGAGCTTACTTTAGC (F1c-F2)
CC-BIPGCGGCAAAGACTTATGATAAAGC-TACCGCCATTCCTAAAACAAG (B1-B2c)
CC-F3TGGGAGCGTTTTTGATCT (F3)
CC-B3AATCAAACTCACCGCCAT (B3c)
CC-LFCCACTACAGCAAAGGTGATG (LFc)
CC-LBCCACGATAGCCTTTATGGA (LB)
  • a Presumed to encode an oxidoreductase in the accession number AL111168 sequence, which was submitted to GenBank by Parkhill et al. (28).

  • b Presumed to be a gufA gene in the accession number AAFL01000003 sequence, which was submitted to GenBank by Fouts et al. (6).