TABLE 2.

Primers used in this study

TargetPrimerSequence (5′ → 3′)E. coli positionReference
Bacteria8FAGAGTTTGATYMTGGCTC8-2721
1492RGGYTACCTTGTTACGACTT1492-1507
Archaea109FACKGCTCAGTAACACGT109-12512
934RGTGCTCCCCCGCCAATTCCT915-934
Methanoculleusa298FGGAGCAAGAGCCCGGAGT298-31510
586RCCAAGAGACTTAACAACCCA586-606
Methanothermobactera410FCTCTTAACGGGGTGGCTTTT410-44010
667RCCCTGGGAGTACCTCCAGC667-686
Uncultured groupa195FAAAACTCCGGTGCCTTAGGATT195-23010
330RCCCGTAGGGCCTGGACTCA330-348
MethanosaetaaMS1bCCGGCCGGATAAGTCTCTTGA585-60628
SAE835RGACAACGGTCGCACCGTGGCC835-851
Methanosarcinaa240FCCTATCAGGTAGTAGTGGGTGTAAT240-26410
589RCCCGGAGGACTGACCAAA589-606
  • a Source DNA for preparing standards: clone 2FA36 (AM947508), Methanoculleus bourgensis; DSM 2970, Methanothermobacter wolfeii; clone 1FA28 (AM947509), uncultured archaea; DSM 2139, Methanosaeta concilii; DSM 800, Methanosarcina barkeri. All pure cultures from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), Braunschweig, Germany.