TABLE 2.

Oligonucleotides for gene disruption

GeneDirectionSequencea
ΔdeoAForwardGTTTCAAACCGGCGGGCGGCGTGCGTACTGCGGAAGATGCGCAGAAATATGTGTAGGCTGGAGCTGCTTC
ReverseGACGGGTCAGATTTGGCAGATTGAGCGGGCCTTTACGACCGTTATCAGCTCATATGAATATCCTCCTTAG
ΔtdkForwardATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACGTGTAGGCTGGAGCTGCTTC
ReverseTTAAGCGTGGCGATGCCTTTCCTGAATAGCCGTTAATGAGTCGACTTGTACATATGAATATCCTCCTTAG
ΔudpForwardTGATGTTTTTCATCTCGGCCTCACTAAAAACGATTTACAAGGGGCTACGCGTGTAGGCTGGAGCTGCTTC
ReverseGAATTACAGCAGACGACGCGCCGCTTCCACCACGATTTTCACCGCATGGCCATATGAATATCCTCCTTAG
ΔungForwardTGATGTTTTTCATCTCGGCCTCACTAAAAACGATTTACAAGGGGCTACGCGTGTAGGCTGGAGCTGCTTC
ReverseGAATTACAGCAGACGACGCGCCGCTTCCACCACGATTTTCACCGCATGGCCATATGAATATCCTCCTTAG
  • a Underlined sequences are priming site sequences for template pKD3.