TABLE 3.

Selected primer sets for selectivity tests

TargetPrimerSequenceSize of PCR product (bp)Annealing temp (°C)Reference
oriCP1TTATTAGGATCGCGCCAGGC1635525
P2AAAGAATAACCGTTGTTCAC
ompCS18ACCGCTAACGCTCGCCTGTAT1595816
S19AGAGGTGGACGGGTTGCTGCCGTT
Random fragmentST11AGCCAACCATTGCTAAATTGGCGCA429601
ST15GGTAGAAATTCCCAGCGGGTACTG
invA139GTGAAATTATCGCCACGTTCGGGCAA2846421
141TCATCGCACCGTCAAAGGAACC