TABLE 1.

Oligonucleotide primers used for PCR amplification reactions

OligonucleotideSequence (5′ → 3′)a
P(SgsE)_HindIII_forAATCAAAGCTTTGTTTTTGCACAAAATGTTTGCC
P(SgsE)_SphI_revAATCAGCATGCAGCCTAAAATCCCCCTTCG
P(SgsE)_SphI_forAATCAGCATGCTGTTTTTGCACAAAATGTTTGCC
P(SgsE)_HindIII_revAATCAAAGCTTAAAGCCTAAAATCCCCCTTCG
Targe_SphI_forAATCAGCATGCGCTGGCGTAATAGCGAAGA
Targe_SphI_revAATCAGCATGCTACCGCACAGATGCGTAAG
KO_wsfP_control_for_1TCTTATCCTTGGTGCCGGTACACTTG
KO_wsfP_control_rev_1AGCCTGTAATTCCAGGACGCACA
wsfP_for_SphIAATCAGCATGCTTCGCAAAAATCAAAGGTTTTTGTCGAAG
wsfP_rev_KpnIAATCAGGTACCTTAATATGCATTTTTATTTATAAACCCATTCC
wsaP_for_SphIAATCAGCATGCTGGTTAAGGTGATTAGAGGAAGAGAGCGG
wsaP_rev_KpnIAATCAGGTACCTTAATATGCATTTTTATTTACCAAACCATTGG
P_555 556s-IBSAAAAAAGCTTATAATTATCCTTAGCTGACTGGAAAGTGCGCCCAGATAGGGTG
P_555 556s-EBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCTGGAAAACTAACTTACCTTTCTTTGT
P_555 556s-EBS2TGAACGCAAGTTTCTAATTTCGATTTCAGCTCGATAGAGGAAAGTGTCT
P_654 655s-IBSAAAAAAGCTTATAATTATCCTTAATTCTCGCACTAGTGCGCCCAGATAGGGTG
P_654 655s-EBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCGCACTACCTAACTTACCTTTCTTTGT
P_654 655s-EBS2TGAACGCAAGTTTCTAATTTCGGTTAGAATCCGATAGAGGAAAGTGTCT
P_1176 1177s-IBSAAAAAAGCTTATAATTATCCTTAAGACCCGAACGGGTGCGCCCAGATAGGGTG
P_1176 1177s-EBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCGAACGGCCTAACTTACCTTTCTTTGT
P_1176 1177s-EBS2TGAACGCAAGTTTCTAATTTCGATTGGTCTTCGATAGAGGAAAGTGTCT
Cm_KpnI_forAATCAGGTACCAAGCCGATGAAGATGGA
Cm_KpnI_revAATCAGGTACCACAGTCGGCATTATCTC
  • a Artificial restriction sites are underlined.