TABLE 2.

Primers designed in this study

PrimerTarget geneNucleotide sequence (5′-3′)aProduct size (bp)
Primers for pXO1- and pXO2-like replication genes
    repX-F4 repX CACGTGATGCWGAGGCTTTA850
    repX_R2 repX GATAATTTCTTCTTTGYTGGTTGTGA
    repX_F1 repX CCATATCGTGCGATTCTTG583
    repX_R1 repX GAGCAAATTCACTCGCATCA
    repA_F1 repA TAAATCTAAAAAYTCRAAAGCTG576
    repA_R3 repA GGCATTCTGAAGAAVCCAAA
    repA_F1 repA TAAATCTAAAAAYTCRAAAGCTG1,183
    repA_R2 repA GTGTAAAGTATAGCACAGGT
    repA_F2 repA GGACARGCTTCTCACTGGAC386
    repA _R3 repA GGCATTCTGAAGAAVCCAAA
Primers for type IV-like secretion system genes
    MB11_F1 virB11 TGTTGTGTCTGAACTTGTTGGGAC661
    MB11_R1 virB11 CCACGAAGCTCAGAAATCATAA
    MB4_F2 virB4 GATAAAGCAARRGATTATTACACA1,089
    MB4_R2 virB4 CTGACCACCTTTAAAGCGTTCTAA
    MD4_F2 virD4 TAGAYGAGTTTGGDAAYATGC585
    MD4_R2 virD4 TCYYTTTTHGCAACTGGATT
Primers for group II introns
    B.th.I1_F1 virB4 (ORF9)TAGAACGCTTTAAAGGTGGTCAG711 or 3,317b
    B.th.I1_R2ORF6GTTACCGCCATTGATATAGCG
    MD4_F1 virD4 TAGGGGTTTCTCGTTCAGGTAAAGG573 or 1,522b
    MD4_R1 virD4 TTTCWCCBGCAAAGCTAGTTGA
Primers for detecting mobilizable plasmids pUB110 and pBC16
    pUB110_F ble c TGAGGCATTTTCGCTCTTTCC732
    pUB110_R ble ATGGGAGGCAAGTGATGAAGG
    pBC16_F tet d TGGTTTTGAACGTCTCATTACC434
    pBC16_R tet AGGAATGAGTAGAAGATAGGACC
  • a W = A or T; Y = C or T; R = A or G; V = A, G, or C; H = A, C, or T; D = A, G, or T; S = G or C; K = G or C; N = A, G, C, or T; B = G, C, or T.

  • b Primer pairs Bth1_F1/Bth1_R2 and MD4_F1/MD4_R1 were designed to flank the group II introns B.th.I.1 and B.th.I.2, respectively. Therefore, the amplicons were two different sizes; the first value is the size without the intron, and the second value is the size with the intron.

  • c Bleomycin resistance gene.

  • d Tetracycline resistance gene.