TABLE 1.

Sequences of the primers and probes used in this study

Primer or probeTargetSequence (5′ → 3′)Reference
Primers
    P338FBacteriaACTCCTACGGGAGGCAGCAG49
    P518rUniversalATTACCGCGGCTGCTGG49
    CTO189ABβ-Proteobacteria ammonia oxidizersGGAGRAAAGCAGGGGATCG34
    CTO189Cβ-Proteobacteria ammonia oxidizersGGAGGAAAGTAGGGGATCG34
    CTO653rβ-Proteobacteria ammonia oxidizersCTAGCYTTGTAGTTTCAAACG34
    GC-clampCGCCGGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG45
Probes
    NSO 190β-Proteobacteria ammonia oxidizersCGATCCCCTGCTTTTCTCC44
    EUB338Most bacteriaGCTGCCTCCCGTAGGAGT4
    EUB338 IIPlanctomycetalesGCAGCCACCCGTAGGTGT18
    EUB338 IIIVerrucomicrobialesGCTGCCACCCGTAGGTGT18