TABLE 1.

Primer sequences for the amplification of Campylobacter species DNA from bovine feces

PCR target and geneaPrimerTm(°C)Sequence (5′ to 3′)Size (bp)Reference or source
Campylobacter genus and internal control
    16S rRNAC412F58GGATGACACTTTTCGGAGC816Linton et al. (29)
C1228RCATTGTAGCACGTGTGTCLinton et al. (29)b
Campylobacter coli and C. jejuni
    16S rRNAMD 16S1Upper58ATCTAATGGCTTAACCATTAAAC857Denis et al. (9); CCCJ609F modified from Linton et al. (30)
MD16S2LowerGGACGGTAACTAGTTTAGTATTDenis et al. (9); CCCJ1442R modified from Linton et al. (30)
Campylobacter coli and C. jejuni primary multiplex
    ceuE (C. coli)COL3Upper58ATTTGAAAATTGCTCCAACTATG462Gonzales et al. (16)
MDCOL2LowerTGATTTTATTATTTGTAGCAGCGDenis et al. (10); COL2 modified from Gonzalez et al. (16)
    mapA (C. jejuni)MDmapA1 UpperCTATTTTATTTTTGAGTGCTTGTG589Denis et al. (10)
MDmapA2LowerGCTTTATTTGCCATTTGTTTTATTADenis et al. (10)
Campylobacter coli and C. jejuni nested multiplex
    ceuE (C. coli)CCceuEN3F58AAGCGTTGCAAAACTTTATGG330New primerc
CCceuEN3RCCTTGTGCGCGTTCTTTATTNew primerc
    mapA (C. jejuni)CJmapAN3FTGGTGGTTTTGAAGCAAAGA413New primerc
CJmapAN3RGCTTGGTGCGGATTGTAAANew primerc
Campylobacter fetus and C. lanienae primary multiplex
    23S rRNA (C. fetus)FET156CTCATAATTTAATTGCACTCATA784Bastyns et al. (3)
HYOFET23SRGCTTCGCATAGCTAACATNew primer
    16S rRNA (C. lanienae)CLAN76FGTAAGAGCTTGCTCTTATGAG920Logan et al. (31)
CLANL521021RTCGTATCTCTACAAGGTTCTTAdNew primer; CLAN1021R modified from Logan et al. (31)
Campylobacter fetus and C. lanienae nested multiplex
    23S rRNA (C. fetus)FETNF56CGATAATTGATGTGAGAATCATC473New primer
HYOFET23SR2GGGAGTAAATCTTAATACAAAGTTAGGNew primer
    16S rRNA (C. lanienae)CLANNFTAGTTGGTGAGGTAATGGCTC360New primer
CLANNRGCAGTTTAATGGTTGAGCCANew primer
Campylobacter hyointestinalis primary
    23S rRNAHYO1F54ATAATCTAGGTGAGAATCCTAGd611New primer; HYO1 modified from Bastyns et al. (3)
HYOFET23SRSee HYOFET23SR aboveNew primer
Campylobacter hyointestinalis seminested
    23S rRNAHYO1F54See HYO1F above468See above
HYOFET23SR2See HYOFET23SR2New primer
  • a Primary PCRs were also used to identify Campylobacter species isolated from feces.

  • b There was a typographical error in Linton et al. (29): primer 1288 should have read primer 1228.

  • c Developed with Primer3 software.

  • d Bold type indicates regions of the primer that were modified.