TABLE 1.

PCR assays for tetracycline resistance genesa

GenePCR primersSpecies (plasmid)Strain sourceb (designation)
Efflux resistance genes
    tetACCTGCGCGATCTGGTTCACT Pseudomonas aeruginosa (RP1)NCTC (NC050076)
    GCCAGCGAGACGAGCAAGA
    tetBTTTCACCGCATAGTCCCTTT E. coli (R222Jap)NCTC (NC050019)
    CGGGAATTTGGCCTATCAAT
    tetCGCCTATATCGCCGACATCAC E. coli (pSC101)NCTC (NC050436)
    GTAGGTTGAGGCCGTTGAGC
    tetDCATCTGCCGTTTGTCATTGC E. coli (RA1)NCTC (NC050073)
    ACAGCGCCAGAGGTTTAAGC
    tetEGCTGACGGTTGTGGCCTATT E. coli (pSL1456)NCTC (NC050273)
    CGCGGGTTGCACTATACAAA
    tetGTTCAAGCCGGCTTGGAGAG E. coli (pJA8122)MR
    TTGTTTGAGAGCATTGCCTGC
    tetHAGCGCTTGTTGCCAATAGGAC E. coli (pVM112)MR
    CCAAAGACATACCGATAGAAGTTGTG
    tetKGTACAAGGAGTAGGATCTGCTGCAT Staphylococcus aureus (pT181)NCTC (NC050585)
    TTATTCCCCCTATTGAAGGACCTAA
    tetLTGAACGTCTCATTACCTGATATTGC Eaterococcus faecalis NADC (TspigL)
    TTTGGAATATAGCGAGCAAC
M. elsdenii mosaic tet genesc
    tet(O) product 1ACGGARAGTTTATTGTATACC E. coli (pAT121)NCTC (NC050500)
    TGGCGTATCTATAATGTTGAC
    tet(W) product 2GAATTCTTGCCCATGTAGAC E. coli (pIE1120)MR
    AAGAGCGGTACACCTCCG
    Mosaic tet product 3ACGGARAGTTTATTGTATACC M. elsdenii This study (7-11, 14-14)
    AAGAGCGGTACACCTCCG
    tet(O) product 4TTCGGAAATTATAGTGAAGCA E. coli (pAT121)NCTC (NC050500)
    CGGAACATACATCTCTGTGA
    tet(W) product 5CTGCGGGATACGGTGGC E. coli (pIE1120)MR
    ACCTCCAACTGCACCCGG
    Mosaic tet product 6GCCCCCCTCCCCATGC M. elsdenii This study (7-11)
    AGGGAGCGGCTCTATGGA
    Mosaic tet product 7CTGGGATACTTGAACCAGAGT M. elsdenii This study (14-14)
    GGCTGGTATCCTTTTAACTC
    tet(O) product 8TCAGATAAAGAATGACGAGGT E. coli (pAT121)NCTC (NC050500)
    GGCTGGTATCCTTTTAACTC
    tet(W) product 9CCAGGTAAAAAAGGATGAAGT E. coli (pIE1120)MR
    GCCTGATATCCTTTCAGCTC
  • a Gene target, PCR primers, validation strain, and strain source for PCR assays used to screen intestinal bacteria in these studies. Primer pairs are listed as forward (top) and reverse (bottom) beginning with their 5′ nucleotide positions.

  • b NCTC, National Culture Type Collection, Public Health Laboratory Service, London; NADC, National Animal Disease Center; MR, Marilyn Roberts, University of Washington.

  • c PCR primers used to analyze M. elsdenii mosaic tet genes. Products of the PCR amplifications and corresponding tet gene regions are depicted in Fig. 4.