TABLE 1.

Oligonucleotide probes used for FISH and microarray hybridization experimentsa

Probe nameProbe sequence (5′-3′)Target site (positions)Target organism(s)Reference(s)
EUB338GCTGCCTCCCGTAGGAGT338-355Most but not all Bacteria1, 12
EUB338-IIGCAGCCACCCGTAGGTGT338-355 Planctomycetales 12
EUB338-IIIGCTGCCACCCGTAGGTGT338-355 Verrucomicrobiales 12
Nso1225CGCCATTGTATTACGTGTGA1224-1243Most but not all beta-proteobacterial AOB (30)38
Nso190CGATCCCCTGCTTTTCTCC189-207Many but not all beta-proteobacterial AOB (30)38
Nsv443CCGTGACCGTTTCGTTCCG443-461 Nitrosospira cluster 1-3 (30)38
NcmobTCCTCAGAGACTACGCGG174-191 Nitrosococcus mobilis (30)26
NEUCCCCTCTGCTGCACTCTA651-668Most halophilic and halotolerant nitrosomonads (30)71
CteTTCCATCCCCCTCTGCCG659-676Competitor probe for NEU; Comamonas spp., Acidovorax spp., Hydrogenophaga spp., Aquaspirillum spp. (30)71
6a192CTTTCGATCCCCTACTTTCC192-212 Nitrosomonas oligotropha lineage52
c6a192CTTTCGATCCCCGACTTTCC192-212Competitor probe for 6a192; Nitrosomonas eutropha52
NONEUBACTCCTACGGGAGGCAGC74
NONSENSEAGAGAGAGAGAGAGAGAG32
CONTAGGAAGGAAGGAAGGAAGControl oligonucleotide32
CONT-COMPCTTCCTTCCTTCCTTCCTComplementary to CONT32
  • a More detailed information for each probe can be obtained at the oligonucleotide online resource probeBase (33). All but CONT and CONT-COMP were used for FISH. All but EUB338-II, EUB338-III, and Cte were used for microarray analysis.