TABLE 1.

Bacterial strains and primers used in this study

Strain or primerDescriptionSource or reference
S. pneumoniae strains
    R614
    CP1296R6 derivative, cbp3::kan-rpsL+; Kmr Sms27
    R6SR6 but Smr by selection of mutantsThis study
    R6JR6S but cps::kan-rpsL+This study
    TIGR429
    TIGR4STIGR4 but Smr by selection of mutantsThis study
    TIGR4JTIGR4S but cps::kan-rpsL+, by transformation with TTM01-04 PCR product from R6J; Kmr SmsThis study
    NY00216Donor of type 6B capsule26
    GA02224Donor of type 7F capsule26
    GA02190Donor of type 14 capsule26
    GA71Donor of type 19F capsule6
    TIGR4:6B1TIGR4J derivative kan-rpsL+::cps6B, by transformation with NY00216 chromosomal DNA; Kms SmrThis study
    TIGR4:6B2TIGR4J derivative kan-rpsL+::cps6B, by transformation with TIGR4:6B1 chromosomal DNA; Kms Smr; 1× backcross transformantThis study
    TIGR4:6B3TIGR4J derivative kan-rpsL+::cps6B, by transformation with TIGR4:6B2 chromosomal DNA; Kms Smr, 2× backcross transformantThis study
    TIGR4:6B4TIGR4J derivative kan-rpsL+::cps6B, by transformation with TIGR4:6B3 chromosomal DNA; Kms Smr; 3× backcross transformantThis study
    TIGR4:7F4TIGR4J derivative kan-rpsL+::cps7F, serotype 7F 3× backcross capsule transformant of TIGR4 constructed as TIGR4:6B4; Kms SmrThis study
    TIGR4:144TIGR4J derivative kan-rpsL+::cps14, serotype 14 3× backcross capsule transformant of TIGR4 constructed as TIGR4:6B4; Kms SmrThis study
    TIGR4:19F4TIGR4J derivative kan-rpsL+::cps19F, serotype 19F 3× backcross capsule transformant of TIGR4 constructed as TIGR4:6B4; Kms SmrThis study
    GA032946B serotype penicillin-resistant isolate, donor of pbp2x for 607S transformation26
    GA033066B serotype cefotaxime-susceptible isolate26
    607SGA03306 but Smr by selection of mutantsThis study
    621607S but cefotaxime resistant by transformation with pbp2xf-pbp2xr2 PCR product of GA03306This study
    622621 but Sms Kmr by transformation with DAM313-DAM316 PCR product of CP1296This study
Primers
    DAM406TCTATGCCTATTCCAGAGGAAATGGATD. A. Morrison
    DAM351CTAGGGCCCCTTTCCTTATGCTTTTGGAC27
    DAM313AGCTTTCTCGTGGTGTAGAACAAC27
    DAM316CTCTCAAGGTCGCCCAGCTATG27
    TTM01ATCATGACCTCCCTCGTATTGT within dexB in R6; 932-953This study
    TTM02CGCGGATCCTTAATAGTGGGAATTTG; positions 7-26 correspond to positions 131-150 downstream of the dexB 3′ end in R6This study
    TTM03TTTGGGCCCGCCGGCGTCAGTCAGTTTT; positions 10-28 correspond toThis study
positions 618-600 upstream of aliA 5′ end in R6
    TTM04AGCTTTGACTGCCGCGTATTCTTC; within aliA in R6; 331-354This study
    TTM05AAGGTGAGGAGATTGGGATGA; within dexB in R6; 1049-1069This study
    TTM06TGTCGCAGCCTTAGCAGTTG; within aliA in R6; 155-174This study
    1430TGTCCAATGAAGAGCAAGACTTGACAGTAG15
    TTM07CTACTGTCAAGTCTTGCTCTTCATTGGACA; sequence reverse to 1430This study
    1402CAATAATGTCACGCCCGCAAGGGCAAGT15
    TTM08ACTTGCCCTTGCGGGCGTGACATTATTG; sequence reverse to 1402This study
    TTM09CTAAAACAGGGGAAATTCTGGCAACAACGC; within pbp2x in TIGR4; 887-916This study
    TTM10AATCGCGAAACGTCCCAGCCGTGGAAACTC; within pbp1a in TIGR4; 1280-1309This study
    pbp2xfCGTGGGACTATTTATGACCGAAATGGAG10
    pbp2xr2GGCGAATTCCAGCACTGATGGAAATAA10