TABLE 1.

List of oligonucleotides used in this study

TargetSequence (5′-3′)Product size (bp)Annealing temp (°C)
Forward primerReverse primer
Msil2632GCGGCATAGTTGGATTGTTTCATTCCAGCAAGATCGAACC41255
Msil2633CTGCGAAAATCTTCGACCTCGATCGAGCCTTTGACGAGAA40055
Msil2634CTGAAAATTCCCGTCACCATTTCTCCCAATCGGTGATTTC42155
Msil2635CAAAGAGTGTGGCGTCAAGATCTCGGTGATGACGTCGTAG46055
Msil2636CGTGCTCAATCTCTGCCATAGAATCCCTTGGTGGTTTCAA32755
Msil2638GGCCGCAATATTTCCCTATTTCGCAGATTGTGATCTCAGC51060
Msil2639GACCGTGTTTGACGTCTCGTCCGTCAACGCATGATAGAG25060
Msil2632/Msil2633CCGATCAATATGTCGCCTTCTGACGTCGCCTTTCACATAG42355
Msil2633/Msil2634GCGCCTTGTATCATTTCCACGCGCTTGGAGATTTTCTGAC59855
Msil2634/Msil2635CGCCTTGCAAACTACCTTTCTATCAAGCCATGTCGCAAAG41155
Msil2635/Msil2636CATCAGGAATGGCAGGATTTCGAATTCCTTGGCGAGATAA33355
Msil2636/Msil2638AATCGAAGGGCTGTTCTTCACGTGTCGCCGAAATATCC59160
Msil2638/Msil2639CGCTGAACGATCGCAAACGAGCGACGCCAACAGCTC54760
Construction of gmas mutantCCTGAGAATTCATGATCATGTCGGCATCCCTGGAAGGATCCTCAGCAGTCGAGCGTCTGCTC1,30852
Amplification of kan gene cassetteGGTAGGTCGACGCATGCGAGCTCGGAAAGCCACGTTGTGTCTCGGTAGGTCGACGCATGCGAGCTCAAGGTGTTGCTGACTCATAC1,18455
Confirmation of gmas::kan mutantGCCTTGCAAACTACCTTTCGCGAATTCCTTGGCGAGATAA2,591 (for mutant), 1,665 (for wild type)55