TABLE 2.

Primers used in multiplex amplification of MLGT assay

Amplicon (size)PrimerRegionSequence (5′ to 3′)a
1 (1,973 bp)dnaE-FACCGGATTTTCDCTTGGAGAAGCAG
dnaE-RACCCRCCGACAACAGARCCCATAC
2 (1,782 bp)hisS-FAMICTTTCAGCRAGCGATTTATCAC
hisS-RAMICGAACAACMGAAGCRGTCCC
3 (2,618 bp)pdh-FPDHACTTATCTGGCACGGACTTCC
pdh-RPDHTTTACGTACAGAAGGCATTGC
4 (2,479 bp)hly-F2VGCGAAGGAGAGTGAAACCCATG
mpl-RVGCCTCGCAACTTCYGGCTCAGC
5 (2,152 bp)actA-FVGCCCAAYTGCATTACGATTAACC
plcB-RVGCCAAGCACATACCTAGAACCAC
6 (2,220 bp)inlA-F2INLACGAAYGTAACAGACACGGTC
inlA-R2INLCTACTTCTATTTACTAGCACG
7 (1,750 bp)inlB-F2INLAATCAAGGAGAGGATAGTGTG
inlB-RINLCTACCGGRACTTTATAGTAYG
8 (1,680 bp)sigB-FSIGCATTACAACTTCCTGCCAAGC
sigB-RSIGGAACAAGTCCATCTGAATGCA
9 (2,052 bp)lmo0300-FLMOGATTGGATTAAGTACGAGC
lmo0298-RLMOCTCTTATCAATGTGAAGGTGC
  • a See IUPAC codes for the definition of degenerate bases.