TABLE 1.

Gene targets and primers

Locus tagaGeneFunctionForward primerReverse primerE valueSource or reference
General
16S rRNASSU ribosome (5 copies)TGATCCTGGCTCAGGACGAATGCAAGCACCAATCAATACCA1.907
    lp_0006gyrBDNA gyrase BGGAATTGATGAAGCCCTAGCAGGAATCCCACGACCGTTATCA1.90This study
    lp_0537ldhLl-Lactate dehydrogenaseTGATCCTCGTTCCGTTGATGCCGATGGTTGCAGTTGAGTAAG1.92This study
    lp_0727groESChaperoneCCCAAAGCGGTAAGGTTGTTCTTCACGCTGGGGTCAACTT1.97This study
    lp_1021rpoBDNA-directed RNA polymeraseCACCGTACCCGTAGAAGTTATGCGGAGACCTTGATCCAAGAACCA1.91This study
    lp_1027fusA2Elongation factor GCCCATGATGGTGCTTCACAATCGTGGCAGCAGAGGTAATG1.897
    lp_1144pcrAATP-dependent DNA helicaseAGGAGGTCTGGGTCTCAACGAAGGTCCGTTGCTCGCTAGT1.95This study
    lp_1898pfk6-PhosphofructokinaseGTGGCGACGGTTCTTACCATCCCTGGAAGACCAATCGTGT1.937
    lp_2187ileSIsoleucine-tRNA ligaseGGCACCTTACGTTCCTGGTTCGTCATCTTCTTGCGGTCAT1.90This study
    lp_2301recARecombinase AGGCAGAACAGATCAAGGAAGGTATCCACTTCGGCACGCTTA1.91This study
ivi gene
    lp_0017proAGulamate-5-semialdehyde dehydrogenaseCGTGAGTTTGCCAGATCCAACATGCCGATAACACCTAATGG2.00This study
    lp_0237Integral membrane protein (hypothetical)GTACTGATATGGTTGTCGGGAATTAACGGGTGCGTAGAAGAAGC1.927
    lp_0419plnIMembrane-bound protease, immunity proteinCGCTTCGATGATGACTGCTTCTGACCATACGGGCTGTGAT1.91This study
    lp_0775argGArgininosuccinate synthaseGCTCTTGCACCGGATATCAATTTCTTCTTCCCGTGACCAGT2.007
    lp_0800Cell surface protein precursorCGATTAATGCGGCAACAACACCGGTTGTTCAGCCTTTGAG1.90This study
    lp_1019clpCclpC (mecB gene)TTCGCAAGCTAGGTGTCAGTGAGGTTGGCGTTCCTTCAGTC2.00This study
    lp_1164celBCellobiose PTS, EIICGGGCATCTTCCTCGCACTATTCGATCTCCTGGTGGATGTGT1.91This study
    lp_1403Cell surface proteinAGTCCCAGTCGATGCTAACGCGTCAGGCGAATACAACCAT1.99This study
    lp_1603hemHemolysin homologueTGGTTCAGTCGTTGCCCTAAAACAGCAGGATCACGGACAA1.82This study
    lp_2940Cell surface protein precursorATGGCACGGTCAGTTTAGCATTGCACCGCTTGTGTTACCT1.88This study
    lp_3055copACopper-transporting ATPaseCGCACTTGTGACCACTTTCGTTCCGCTTCCTTGGCTTGTA1.95This study
    lp_3176pkn2Serine-threonine protein kinaseCAACGGAGCGATCTATATTCGTGCCCATGTTGAATCCTGTGT1.94This study
    lp_3473ram2RhamnosidaseCAACCACGCTGACGTTACCACCGTGACCACTGGATTGCTA1.91This study
    lp_3660rbsK3RibokinaseTTATTGGTGCGGTTGGTGACTCTTTGTGATCCCTGCCAAG1.93This study
    lp_3662adhEAlcohol and acetaldehyde dehydrogenaseGCCGCACTGGACAATCATATCGCTGGCGTAGATGTTCTT1.99This study
  • a Designated gene number for the annotated L. plantarum WCFS1 chromosome.