TABLE 2.

Primers used in this study

Primer use and target gene(s)Primer nameSequencea (5′→3′)
Gene amplification
    Mlut_13230 #1MLprimer_F1TACTGAATTCGAAGGAGGGTCCTGGTGACGAACGTGT
MLprimer_R1TTCATCTAGACCCACTAGTTGGCTCCTTCAGC
    Mlut_13230-13250MLprimer_F2AGACACTAGTAGGAGGATTGGTCCTGGTGACGAACG
MLprimer_R2ATCTCTAGAGTTTCCCGAACGAAAGCTC
    Mlut_09290MLprimer_F3CATGGAATTCAGACCCAGAGGCAGCAGACC
MLprimer_R3GCCCACTAGTCTCCGGCTCAGACGCTGC
    Mlut_09310MLprimer_F4CATGGAATTCGGCAGAGAGAGGCACCATGA
MLprimer_R4GCCCACTAGTGTACGTGGACAGTGAATCAGACGG
    Mlut_13230 #2MLprimer_F5TCACATATGGTGACGAACGTGTCCGGCAA
MLprimer_R5AGTGTCGACTTGGCTCCTTCAGCTCACCA
    Mlut_13240MLprimer_F6CTATACTAGTGCTCGAGATCGAATGGTGAGCTGAAGG
MLprimer_R6ATCATCTAGAGTCGAGGCCGACGTCGTAGCCGAAG
    Mlut_13250MLprimer_F7GATTTCTAGACGCCGGCGGGAAGGTGGGTG
MLprimer_R7AAGTCCTGCAGGGGACGGGCGCTCGTTCCGGC
Real-time PCR
    Mlut_13230qPCR_MLprimer_F1CCTGATCAAGGACGGTCTCG
qPCR_MLprimer_R1CTGGTGGGTGATGAATCGGT
    Mlut_13240qPCR_MLprimer_F2ACACCGACCAGCAGAGCAAG
qPCR_MLprimer_R2GTGGTGATCACGTGCTGGAG
    Mlut_13250qPCR_MLprimer_F3AGTACGAGGCCGTGAACGTG
qPCR_MLprimer_R3GGGAGGAGACGTGGACGAAG
  • a Underlined sequences indicate restriction sites used for cloning purposes.