TABLE 2.

Oligonucleotide primers used in this study

Oligonucleotide primerNucleotide sequenceaPositionb
ColK1TCACTCGAGCATGGCTAAAGAAC2527-2555
TAAGTGGATATGGACC
ColK2CCACGCGTTAAATCCCTAACAA4172-4143
CTCATTAAGTTTGCTC
cka1CAGAGGTCGCTGAACATGAAAC3263-3284
cka2CTCAGCTAAACGCTTCTCTGCTT3336-3314
P1TAACCGGGAAGGGGCGAGAGTTCT6268-6291
P2GAATGAACTGGACGCCGACG5737-5718
P3TTCTGAACTGACGGGGATCGC4591-4611
P4TGAAACACGCCAGTTCGCCC1899-1918
P5GCTTCCAGGGCCGCTCTTCCT7154-7134
PK1GGCGTATTTTCCCCGGTTTC673-692
PK2TGGTGCCAGCCAGTCTGCTC594-575
PK3GGGCGAACTGGCGTGTTTCA1918-1899
PK4ACACCCTTGTTGCTGCCGGA2234-2215
PK5TCCGGCAGCAACAAGGGTGT2215-2234
PK6AGCTGCGTGGCCTTTTCCGG5216-5235
PK7TCCGCCTTTCTCCCTTTGGG5054-5035
PK8TACAGCGCCCCTTTCAGCCT6881-6862
PK9AGGAAGAGCGGCCCGGAAGC7134-7154
PK10AGGCTGAAAGGGGCGCTGTA6862-6881
PK11CCCCTTCACGGATTTGCAGC7531-7550
mob1GGCAGTGGTCCGGTTGAT6230-6248
mob2TGCAGCCCGTAATGGTGA6630-6612
rna1AGGATCTTCTTGAGATCCTT4632-4652
rm2TATCCACAGAATCAGGGG5291-5273
rom1AAGCGGGCCATGTTAAGG5774-5792
rom2AATCAACCGGACCACTGC6248-6230
  • a Nucleotides in boldface correspond to introduced XhoI and MluI restriction sites.

  • b Numbers indicate positions on plasmid pColK-K235.