TABLE 2.

Primers used in this study

PrimerSequenceProduct size (bp)TargetUtility
VvhaFCCGCGGTACAGGTTGGCGC521Hemolysin/cytolisin geneV. vulnificus-specific sequence
VvhaRCGCCACCCACTTTCGGGCC
PilFFCGATTGGTAGGCAATAGAC917pilFPrimers to sequence pilF gene
PilFRGCAACTCAACCTCAAGACG
VvpdhFTGTCGGTGAAAACGGCAAAGCTG338pilFV. vulnificus strains potentially dangerous for humans
VvpdhRGGTATCGATTTCCAACTTAGCGAGGTTGAGCACC