TABLE 2.

Primer sequences used in this study

Primer use and primerSequence (5′-3′)a
RT-PCR analysis
    insxRFCCTAACAGCAATGCTCATGG
    insRRACTACTGGATGCACTGTCGG
    intRCFACAGTGCATCCAGTAGTGGC
    intRCRAGGCTAGCACAGTCATTCCG
    insCFACGGAATGACTGTGCTAGCC
    insCRGGATGAACTGAGCAGTCTTGG
    intCA2FCGAGAAGTGGAAGAAGGTGC
    intCA2RTTGTGAGAGGCGATTCAGC
    intA2A3FGCTGCCTAACAACTGGAAGC
    intA2A3RGCAATAGTGGCAATCCTTGG
    intA3BFTGTCGACAACCATGATGAGG
    intA3BRACGATGTCTTGAAGAAGCGG
    intBA1FACGACCTGTATGTAGCCATGC
    intBA1RATAGTGCTGAAGCGACCACC
    insA1FGATCCATATCCACGACTCCG
    insA1RATGGCGCTAGGAAGATACAGG
Primer extension
    PEtphC110GGCACGACGATCTTGAGAGG
    PEtphR160GCTGTACCAGTGTGCTGAGC
Construction of promoter-lacZ fusion plasmids
    HRC-F AAGCTT GAGCGAACGTCTGG (HindIII)
    HRC-RGGAACACTAGATCGGCACC
    KRCH-F GGTACC GATAGCCAAGCTGTACC (KpnI)
    KRCH-R AAGCTT CGACGATCTTGAGAGG (HindIII)
Construction of tphRII expression plasmids
    TphRII-F CATATG CAGGACAAGAACTTTGTGG (NdeI)
    TphRII-R CTCGAG CACTACAACCCCTGCG (XhoI)
    EMSAs
    RMF01GTTCTTGTCCTGCATAGCG
    RMF11GACATCCTCATACTGCAGTTCC
    RMR01GTCTGCGAATAGATTCGTTGC
    RMR11AACTGCAGTATGAGGATGTCG
    RM31-FCAACATTTTTGCGCATAGCGCAAAAACAGGT
    RM31-RACCTGTTTTTGCGCTATGCGCAAAAATGTTG
    RM315-FCAACATTTTTaCGCATAGCGCAAAAACAGGT
    RM315-RACCTGTTTTTGCGCTATGCGtAAAAATGTTG
Site-directed mutagenesis
    SMT5C-FGGTGTTTTCAACATTTTcGCGCATAGCGCAAAAACAGG
    SMT5C-RCCTGTTTTTGCGCTATGCGCgAAAATGTTGAAAACACC
    SMC7T-FGGTGTTTTCAACATTTTTGtGCATAGCGCAAAAACAGG
    SMC7T-RCCTGTTTTTGCGCTATGCaCAAAAATGTTGAAAACACC
    SMG8A-FGGTGTTTTCAACATTTTTGCaCATAGCGCAAAAACAGG
    SMG8A-RCCTGTTTTTGCGCTATGtGCAAAAATGTTGAAAACACC
  • a Engineered restriction sites are underlined, and the corresponding restriction enzymes are shown in parentheses. Mutated nucleotides are in lowercase.