TABLE 1.

Oligonucleotides used in this study

PrimerFunctionaSequence (5′-3′)Reference
JV16HC hdcA internal fragment amplification (F)AGATGGTATTGTTTCTTATG 20
JV17HC hdcA internal fragment amplification (R)AGACCATACACCATAACCTT 20
Northern blotting
    CHP5 hdcA probe amplification (F)CCTGGGAACATCGGGACTThis work
    CHP1 hdcA probe amplification (R)AAATAAGGGCCGACGGTGATGThis work
    CHP2R hdcP probe amplification (F)GAATACGGTTGGCGTTTTGGThis work
    CHP3R hdcP probe amplification (R)CGGTAGTCAAAGCTCGTTTGCThis work
    CHP4R hdcB probe amplification (F)TCATGCTCCTAACGGTGAAGGTThis work
    CHP6R hdcB probe amplification (R)TGGGTGATAATCATCGTATTCCAThis work
RT-PCR
    prim1 hdcA amplification (F)CCTGGGAACATCGGGACTGThis work
    prim2 hdcA amplification (R)CGCATCTAACCAATCAGGCAGThis work
    prim3 hdcP amplification (F)GAATACGGTTGGGCTTTTGGThis work
    prim4 hdcP amplification (R)CGGTAGTCAAAGCTCGTTTGCThis work
    prim5 hdcB amplification (F)TCATGCTCCTAACGGTGAAGGTThis work
    prim6 hdcB amplification (R)TGGGTGATAATCATCGTATTCCAThis work
RT-qPCR
    ST tufFNormalizationGGTGCGATCCTTGTAGTTGCA 3
    ST tufRNormalizationACACCAACCTGACGTGAAAGAA 3
    hdcAQF hdcA expression analysis (F)TGCTAACAAAGGTGTGACTGCATThis work
    hdcAQR hdcA expression analysis (R)TTCACCGGCTTGGAAAGGTThis work
  • a F, forward; R, reverse.