TABLE 1.

Oligonucleotides used in this study

OligonucleotideSequence (5′-3′)PositionaReference
NEMFG1TCTCCGATTGATTCTGTCGGCGATTATATG5′ of sequence5
AngioF1ATCATAAACCTTTTTTCGAGTATCCAG456-482This study
NEM2FGCGGTTAAAAAGCTCGTAGTTGG549-5715
NEM2RCCAACTACGAGCTTTTTAACCGC571-5495
NEM3FGCGGCTTAATTTGACTCAACAC1098-11195
NEM3RGTGTTGAGTCAAATTAAGCCG1119-10985
AngioR1TCTCGAGACAGCTCAGTCCCGG1590-1569This study
NEM4RCTCGAAACGGCTCAGTCCCGG1589-15695
CRYPTORGCTTGATCCTTCTGCAGGTTCACCTAC3′ of sequence5
  • a Based on the A. cantonensis 18S rRNA gene GenBank entry (accession number AY295804).