TABLE 3.

Oligonucleotides used

PrimerSequence (5′-3′)aRelevant propertiesPlasmid(s)
TERFGACGGTACCGACTTCGACGACTACTTCGACGt.L11e forward primer; KpnI sitepTA927 pTA962
TERRGGCGGTACCGGGTCGAATCGGGTCGGTGt.L11e reverse primer; KpnI sitepTA927 pTA962
PtnaApa2CGAGTTCTGGGCCCGTTCTCGTCGp.tnaA forward primer; ApaI sitepTA927 pTA962
PtnaNde3CCTTGATCGATTTCATATGCGCAATAGGTCCp.tnaA reverse primer; ClaI and NdeI sitespTA927 pTA962
t.syn FGGCCGCACCTCTGGACCATCGCATTTTTCGGCGCGTop strand of t.Syn fragment; NotI and BstXI endspTA927 pTA962
t.syn RCCGAAAAATGCGATGGTCCAGAGGTGCBottom strand of t.Syn fragmentpTA927 pTA962
HisndeITATGCACCACCACCACCACCACATGTTop strand of 6×His tag; NdeI end; PciI sitepTA929 pTA963
HisclaICGACATGTGGTGGTGGTGGTGGTGCABottom strand of 6×His tag; ClaI end; PciI sitepTA929 pTA963
radANcoFGAACGACTGGCCATGGCAGAAGACGradA forward primer; NcoI sitepTA1041 pTA1182
radABamRCCGACGGATCCACGGCTTACTCGGradA reverse primer; BamHI sitepTA1041 pTA1182
radBBsFCCTCCTGTCATGACAGAGTCAGTCTCCradB forward primer; BspHI sitepTA1043
radBBamR2CCGCGTGGATCCCTTTTCTACACGradB reverse primer; BamHI sitepTA1043
mrrUSFGGATGGTACCGCCGTAGAACAGCGΔmrr upstream external primer; KpnI sitepTA1150
mrrUSRCCGGGGATCCCGTCATCGCTCGACΔmrr upstream internal primer; BamHI sitepTA1150
mrrDSFGGCGGATCCGTCGGCATTTGGCTCΔmrr downstream internal primer; BamHI sitepTA1150
mrrDSRCCGCTCTAGAAGGCCGAGGAGGCCΔmrr downstream external primer; XbaI sitepTA1150
cdc48dUFACGGGTACCCACGTTGCTGGΔcdc48d upstream external primer; KpnI sitepTA1180
cdc48dURGGACGGATCCGTCGAACCGAGΔcdc48d upstream internal primer; BamHI sitepTA1180
cdc48dDFCACGGATCCCCCAGAAATTGCΔcdc48d downstream internal primer; BamHI sitepTA1180
cdc48dDRGCCGAATTCGAGCCGAGGTGGΔcdc48d downstream external primer; EcoRI sitepTA1180
5′Up HindIIIAAGCTTTCCGACCCGATTCGCGTGACΔpitAHvo upstream external primer; HindIII sitepMM1231 pMM1232 pTA1106
3′Up EcoRIGAATTCACGAGGGCCTAGGGAGTCATCCΔpitAHvo upstream internal primer; EcoRI sitepMM1231 pMM1232 pTA1106
5′Down EcoRIGAATTCCTTCGCGACCATCGGGAGCΔpitAHvo downstream internal primer; EcoRI sitepMM1231
3′Down NotIGCGGCCGCCGGCATCGACCGCTTCGACΔpitAHvo downstream external primer; NotI sitepMM1231 pMM1232 pTA1106
5′Down XbaITCTAGACTTCGCGACCATCGGGAGCΔpitAHvo downstream internal primer; XbaI sitepMM1232 pTA1106
5′NatroEcoRIGAATTCATGCCACAACGCCAACCACpitANph forward primer;, EcoRI sitepTA1106
3′NatroXbaITCTAGATCAGGCGAGGAAGACGTGGpitANph reverse primer; XbaI sitepTA1106
pitAFGGAAAATCAAGCAGGTCATCGCForward primer specific to pitAHvoNA
pitARGTAGAACATCCCCATCGTGCCReverse primer specific to pitAHvoNA
NphPitAFGCAGTATGCCGACAAGGTCTCCForward primer specific to pitANphNA
NphPitARCCCGCTCGTTTTTCCACAGReverse primer specific to pitANphNA
mrrFTGGGCGTTCAGGCGAAGCForward primer for mrr probeNA
mrrRCGGGTGAGCGACCAGCGGReverse primer for mrr probeNA
  • a Restriction endonuclease sites used in cloning are underlined; internal sites used subsequently are in boldface. NA, not applicable.