TABLE 1.

Primers used in multiplex amplification for the TMLGT assay

AmpliconPositionaGene(s)PrimerSequence (5′-3′)b
INLa455381-456505inlAinl2-a1GTCCTTGATAGTCTACTG
inl2-a2ACCAAATTAGTAATCTAGCAC
INLb457726-458752inlBinl-f1dGAATTRTTTAGYCAAGAATGT
inlb-rCTACCGGRACTTTATAGTAYG
LMO325116-326096lmo0298-lmo0300lmo-a1AAGGCTTACAAGATGGCT
lmo1a-1rAAATAATAYGTGATACCGAC
VGCa205366-206622plcA, hlyplca-fCTCATCGTATCRTGTGTACC
hly-rTCTGGAAGGTCKTGTAGGTTC
VGCb208447-209465mplra_mpl-fGTGGAYAGAACTCATAAAGG
ra_mpl-rACTCCCTCCTYGTGATASGCT
VGCc209728-211239actAvgc1a-2fTTCMATRCCAGCAGAACG
vgc1a-2rGCAGACCTAATAGCAATGTTG
  • a Corresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number NC_003210).

  • b See IUPAC codes for definition of degenerate bases.