TABLE 1.

Plasmids, primers, and strains used in this study

Primer, strain, or plasmidDescriptionReference
Primers
    pmhAprom-F5′AAGCTTCGGTGATTGCCTTCAGCAAT3′This study
    pmhAprom-R5′AAGCTTAAATCCTCCCGATATCTGCGT3′This study
    lazZ-R5′GTTTTCCCAGTCACGACGTT3′This study
Strains
    P. mendocina ympWild-type strain 23
    ΔpmhA mutantSiderophore mutant of P. mendocina ymp 4
    P. mendocina:pmhA-lacZFusion of pmhA promoter and lacZ integrated into wild-type P. mendocinaThis study
    ΔpmhA:pmhA-lacZFusion of pmhA promoter and lacZ integrated into siderophore mutant of P. mendocinaThis study
Plasmids
    pUC18-mini-Tn7T-GmPlasmid containing site-specific transposable element; used for determination of integration site 10
    pUC18-mini-Tn7T-Gm-lacZPlasmid used for creation of lacZ fusions for bioreporter strain 10
    pTNS2Helper plasmid for pUC18 10