TABLE 2.

PCR primers used in this study

PrimerSequence (5′-3′)a
sigB-1GTGGGAGCTCTTTAGAGAGCATTTACTGGTGA
sigB-2GTGGCCATGGCTTCACCCCATCTAATTTTAAG
sigB-3GCCCATGGAGGTGGAGGAGAATGCCA
sigB-4GCCCCGGGTGATTCAACTGCCTTGTTCAT
sigB-fwdGCCGCTTACCAAGAAAATGG
sigB-revAATATTTTCGGGCGATGGAC
tpi-fwdAACACGGCATGACACCAATC
tpi-revCACGGATTTGACCACGTACC
rpoB-fwdCGTCGTCTTCGTTCTGTTGG
rpoB-revGTTCACGAACCACACGTTCC
16S-rRNA-fwdGATGCATAGCCGACCTGAGA
16S-rRNA-revTGCTCCGTCAGACTTTCGTC
  • a Nucleotides introduced to create restriction sites are underlined.